##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings FLAMES_2.1.1.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’
* using R Under development (unstable) (2024-10-21 r87258)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.2.0-23ubuntu4) 13.2.0
    GNU Fortran (Ubuntu 13.2.0-23ubuntu4) 13.2.0
* running under: Ubuntu 24.04.1 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.1.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ...Warning: unable to access index for repository https://CRAN.R-project.org/src/contrib:
  cannot open URL 'https://CRAN.R-project.org/src/contrib/PACKAGES'
 INFO
Imports includes 43 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.2.0-23ubuntu4) 13.2.0’
* checking C++ specification ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
create_spe: no visible binding for global variable 'barcode'
filter_coverage: no visible global function definition for
  'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
  'which_label'
find_variants_grange: no visible binding for global variable
  'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
  'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
  reads'
plot_demultiplex: no visible binding for global variable 'single match
  reads'
plot_demultiplex: no visible binding for global variable
  'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
  'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
  'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
  definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
plot_spatial_isoform: no visible global function definition for 'head'
plot_spatial_pie: no visible global function definition for 'head'
plot_spatial_pie: no visible binding for global variable 'imageY'
plot_spatial_pie: no visible binding for global variable 'imageX'
relative_mutation_positions: no visible binding for global variable
  'region'
relative_mutation_positions_single: no visible binding for global
  variable 'type'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
  'cell_total_reads'
Undefined global functions or variables:
  . BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
  allele_count bam_index barcode barcode_rank cell_id cell_total_reads
  cnt count counts_no_ins cumpct demultiplexed reads everything expr
  filter_res gene_id head imageX imageY input label length_bin
  max_length min_length multi-matching reads mutation_index n_reads
  name nucleotide output pct pos read1_with_adapter read_counts ref
  region single match reads starts_with total reads total_counts tr_id
  tr_length transcript type undemultiplexted reads value which_label x
  y
Consider adding
  importFrom("base", "match", "single")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  bulk_long_pipeline.Rd: SummarizedExperiment
  sc_long_multisample_pipeline.Rd: SingleCellExperiment
  sc_long_pipeline.Rd: SingleCellExperiment
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
bulk_long_pipeline           17.561  0.782  16.280
plot_isoform_reduced_dim     17.942  0.270  18.206
create_se_from_dir           16.336  0.391  14.247
sc_long_multisample_pipeline  5.137  4.994   6.677
find_isoform                  7.199  0.272   7.516
get_GRangesList               6.255  0.113   6.413
minimap2_align                5.999  0.094   6.138
plot_coverage                 5.476  0.094   5.608
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.21-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 13.2.0-23ubuntu4) 13.2.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |                 if (blocks.size() >= (int)this->Min_sup_cnt) {
      |                     ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |         if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |              ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |                 (right_counts.size() < (int)this->Min_sup_cnt)) {
      |                  ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |                                 for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                                                 ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |                         for (int i = 0; i < new_exons.size(); ++i) {
      |                                         ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                            ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |                         for (int i = 0; i < exons.size(); i+=2) {
      |                                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:122:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  122 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::string get_umi(const std::string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’:
main-functions/flexiplex.cpp:163:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  163 |     if (seq.length() < umi_start + umi_length) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:187:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  187 |     if (read_to_subpatterns.size() > umi_index + 1) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:295:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  295 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:354:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  354 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  356 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:357:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  357 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:396:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  396 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const std::string&, const std::vector<Barcode>&, std::ostream&)’:
main-functions/flexiplex.cpp:421:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  421 |                << (barcode.flank_end == std::string::npos ? "True" : "False")
      |                    ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’:
main-functions/flexiplex.cpp:453:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  453 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:468:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  468 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  473 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’:
main-functions/flexiplex.cpp:730:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  730 |       for (int t = 0; t < sr_v.size();
      |                       ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:735:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  735 |         for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                         ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:737:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  737 |           for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:739:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  739 |           for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’:
main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  268 |   for (int i = 0; i < BASES.size(); i++) {
      |                   ~~^~~~~~~~~~~~~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’:
main-functions/pileup_readid.cpp:342:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
   86 |   unsigned int end;
      |                ^~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’:
main-functions/pileup_readid.cpp:344:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -DR_NO_REMAP -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include  -DSTRICT_R_HEADERS=1  -fpic  -g -O2  -Wall -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.21-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.21-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R Under development (unstable) (2024-10-21 r87258) -- "Unsuffered Consequences"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/Rtmpt1QYMW/file3e7afa7a5b9753/config_file_4094714.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa3d08ade8/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa43cdd034/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa43cdd034/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmpt1QYMW/file3e7afa779777e7/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa779777e7/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa779777e7/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa779777e7/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa7c48bf12/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa7c48bf12/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmpt1QYMW/file3e7afa748d3929/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa748d3929/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa748d3929/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmpt1QYMW/file3e7afa748d3929/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa7c48bf12/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmpt1QYMW/file3e7afa66e8a263/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 18.648   1.052  19.690