Back to Multiple platform build/check report for BioC 3.20:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2024-10-19 11:52 -0400 (Sat, 19 Oct 2024).

HostnameOSArch (*)R versionInstalled pkgs
teran2Linux (Ubuntu 24.04.1 LTS)x86_644.4.1 (2024-06-14) -- "Race for Your Life" 4474
nebbiolo2Linux (Ubuntu 24.04.1 LTS)x86_644.4.1 (2024-06-14) -- "Race for Your Life" 4733
palomino8Windows Server 2022 Datacenterx644.4.1 (2024-06-14 ucrt) -- "Race for Your Life" 4479
lconwaymacOS 12.7.1 Montereyx86_644.4.1 (2024-06-14) -- "Race for Your Life" 4509
kunpeng2Linux (openEuler 22.03 LTS-SP1)aarch644.4.1 (2024-06-14) -- "Race for Your Life" 4457
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 718/2273HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 1.99.0  (landing page)
Changqing Wang
Snapshot Date: 2024-10-18 13:40 -0400 (Fri, 18 Oct 2024)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: devel
git_last_commit: eb779ce
git_last_commit_date: 2024-10-17 23:24:47 -0400 (Thu, 17 Oct 2024)
teran2Linux (Ubuntu 24.04.1 LTS) / x86_64  OK    OK    OK  YES
nebbiolo2Linux (Ubuntu 24.04.1 LTS) / x86_64  OK    OK    OK  
palomino8Windows Server 2022 Datacenter / x64... NOT SUPPORTED ...
lconwaymacOS 12.7.1 Monterey / x86_64  OK    OK    OK    OK  YES
kunpeng2Linux (openEuler 22.03 LTS-SP1) / aarch64  OK    OK    ERROR  

CHECK results for FLAMES on kunpeng2

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.
- See Martin Grigorov's blog post for how to debug Linux ARM64 related issues on a x86_64 host.

raw results


Summary

Package: FLAMES
Version: 1.99.0
Command: /home/biocbuild/R/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings FLAMES_1.99.0.tar.gz
StartedAt: 2024-10-19 05:32:07 -0000 (Sat, 19 Oct 2024)
EndedAt: 2024-10-19 05:45:13 -0000 (Sat, 19 Oct 2024)
EllapsedTime: 785.6 seconds
RetCode: 1
Status:   ERROR  
CheckDir: FLAMES.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings FLAMES_1.99.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.1 (2024-06-14)
* using platform: aarch64-unknown-linux-gnu
* R was compiled by
    gcc (GCC) 12.2.1 20220819 (openEuler 12.2.1-14)
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘1.99.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (GCC) 10.3.1’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... NOTE
  installed size is  5.0Mb
  sub-directories of 1Mb or more:
    data   2.6Mb
    libs   1.3Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: 'IRanges'
  All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
convolution_filter: no visible global function definition for
  'convolve'
filter_coverage: no visible global function definition for
  'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
  'which_label'
find_variants_grange: no visible binding for global variable
  'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
  'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
  reads'
plot_demultiplex: no visible binding for global variable 'single match
  reads'
plot_demultiplex: no visible binding for global variable
  'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
  'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
  'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
  definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
remove_UTR_coverage: no visible global function definition for 'width'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
  'cell_total_reads'
Undefined global functions or variables:
  . BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
  allele_count bam_index barcode barcode_rank cell_id cell_total_reads
  cnt convolve count counts_no_ins cumpct demultiplexed reads
  everything expr filter_res gene_id head input label length_bin
  max_length min_length multi-matching reads mutation_index n_reads
  name nucleotide output pct pos read1_with_adapter read_counts ref
  single match reads starts_with total reads total_counts tr_id
  tr_length transcript undemultiplexted reads value which_label width x
  y
Consider adding
  importFrom("base", "match", "single")
  importFrom("stats", "convolve")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/R/R-4.4.1/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘FLAMES-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: bulk_long_pipeline
> ### Title: Pipeline for Bulk Data
> ### Aliases: bulk_long_pipeline
> 
> ### ** Examples
> 
> # download the two fastq files, move them to a folder to be merged together
> temp_path <- tempfile()
> bfc <- BiocFileCache::BiocFileCache(temp_path, ask = FALSE)
> file_url <-
+   "https://raw.githubusercontent.com/OliverVoogd/FLAMESData/master/data"
> # download the required fastq files, and move them to new folder
> fastq1 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq1", paste(file_url, "fastq/sample1.fastq.gz", sep = "/")))]]
> fastq2 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq2", paste(file_url, "fastq/sample2.fastq.gz", sep = "/")))]]
> annotation <- bfc[[names(BiocFileCache::bfcadd(bfc, "annot.gtf", paste(file_url, "SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf", sep = "/")))]]
> genome_fa <- bfc[[names(BiocFileCache::bfcadd(bfc, "genome.fa", paste(file_url, "SIRV_isoforms_multi-fasta_170612a.fasta", sep = "/")))]]
> fastq_dir <- paste(temp_path, "fastq_dir", sep = "/") # the downloaded fastq files need to be in a directory to be merged together
> dir.create(fastq_dir)
> file.copy(c(fastq1, fastq2), fastq_dir)
[1] TRUE TRUE
> unlink(c(fastq1, fastq2)) # the original files can be deleted
> 
> outdir <- tempfile()
> dir.create(outdir)
> se <- bulk_long_pipeline(
+   annotation = annotation, fastq = fastq_dir, outdir = outdir, genome_fa = genome_fa,
+   config_file = create_config(outdir, type = "sc_3end", threads = 1, no_flank = TRUE)
+ )
Writing configuration parameters to:  /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/config_file_3329519.json 
#### Input parameters:
{
  "pipeline_parameters": {
    "seed": [2022],
    "threads": [1],
    "do_barcode_demultiplex": [true],
    "do_gene_quantification": [true],
    "do_genome_alignment": [true],
    "do_isoform_identification": [true],
    "bambu_isoform_identification": [false],
    "multithread_isoform_identification": [false],
    "do_read_realignment": [true],
    "do_transcript_quantification": [true],
    "oarfish_quantification": [true]
  },
  "barcode_parameters": {
    "max_bc_editdistance": [2],
    "max_flank_editdistance": [8],
    "pattern": {
      "primer": ["CTACACGACGCTCTTCCGATCT"],
      "BC": ["NNNNNNNNNNNNNNNN"],
      "UMI": ["NNNNNNNNNNNN"],
      "polyT": ["TTTTTTTTT"]
    },
    "strand": ["-"],
    "TSO_seq": ["CCCATGTACTCTGCGTTGATACCACTGCTT"],
    "TSO_prime": [3],
    "full_length_only": [false]
  },
  "isoform_parameters": {
    "generate_raw_isoform": [false],
    "max_dist": [10],
    "max_ts_dist": [100],
    "max_splice_match_dist": [10],
    "min_fl_exon_len": [40],
    "max_site_per_splice": [3],
    "min_sup_cnt": [5],
    "min_cnt_pct": [0.001],
    "min_sup_pct": [0.2],
    "bambu_trust_reference": [true],
    "strand_specific": [0],
    "remove_incomp_reads": [4],
    "downsample_ratio": [1]
  },
  "alignment_parameters": {
    "use_junctions": [true],
    "no_flank": [true]
  },
  "realign_parameters": {
    "use_annotation": [true]
  },
  "transcript_counting": {
    "min_tr_coverage": [0.4],
    "min_read_coverage": [0.4]
  }
} 
gene annotation: /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/32cdef59635213_SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf 
genome fasta: /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/32cdef70798944_SIRV_isoforms_multi-fasta_170612a.fasta 
input fastq files: /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef5b77baf6_sample1.fastq.gz
 /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef7841c572_sample2.fastq.gz
output directory: /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6 
minimap2 path: 
k8 path: 
#### Aligning reads to genome using minimap2
	Aligning sample  32cdef5b77baf6_sample1 ...
05:41:27 Sat Oct 19 2024 minimap2_align
Warning in check_forbidden_install("Python packages") :
  cannot install Python packages during R CMD check
Warning in check_forbidden_install("Conda Environments") :
  cannot install Conda Environments during R CMD check
+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda create --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/bins_env 'python=3.8.15' --quiet -c conda-forge -c bioconda --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done

## Package Plan ##

  environment location: /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/bins_env

  added / updated specs:
    - python=3.8.15


The following NEW packages will be INSTALLED:

  _openmp_mutex      conda-forge/linux-aarch64::_openmp_mutex-4.5-2_gnu 
  bzip2              conda-forge/linux-aarch64::bzip2-1.0.8-h68df207_7 
  ca-certificates    conda-forge/linux-aarch64::ca-certificates-2024.8.30-hcefe29a_0 
  ld_impl_linux-aar~ conda-forge/linux-aarch64::ld_impl_linux-aarch64-2.43-h80caac9_1 
  libffi             conda-forge/linux-aarch64::libffi-3.4.2-h3557bc0_5 
  libgcc             conda-forge/linux-aarch64::libgcc-14.2.0-he277a41_1 
  libgcc-ng          conda-forge/linux-aarch64::libgcc-ng-14.2.0-he9431aa_1 
  libgomp            conda-forge/linux-aarch64::libgomp-14.2.0-he277a41_1 
  libnsl             conda-forge/linux-aarch64::libnsl-2.0.1-h31becfc_0 
  libsqlite          conda-forge/linux-aarch64::libsqlite-3.46.1-hc4a20ef_0 
  libuuid            conda-forge/linux-aarch64::libuuid-2.38.1-hb4cce97_0 
  libzlib            conda-forge/linux-aarch64::libzlib-1.3.1-h86ecc28_2 
  ncurses            conda-forge/linux-aarch64::ncurses-6.5-hcccb83c_1 
  openssl            conda-forge/linux-aarch64::openssl-3.3.2-h86ecc28_0 
  pip                conda-forge/noarch::pip-24.2-pyh8b19718_1 
  python             conda-forge/linux-aarch64::python-3.8.15-ha43d526_1_cpython 
  readline           conda-forge/linux-aarch64::readline-8.2-h8fc344f_1 
  setuptools         conda-forge/noarch::setuptools-75.1.0-pyhd8ed1ab_0 
  tk                 conda-forge/linux-aarch64::tk-8.6.13-h194ca79_0 
  wheel              conda-forge/noarch::wheel-0.44.0-pyhd8ed1ab_0 
  xz                 conda-forge/linux-aarch64::xz-5.2.6-h9cdd2b7_0 


Preparing transaction: ...working... done
Verifying transaction: ...working... done
Executing transaction: ...working... done
+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/bins_env 'python=3.8.15' -c conda-forge -c bioconda --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done


==> WARNING: A newer version of conda exists. <==
    current version: 24.3.0
    latest version: 24.9.2

Please update conda by running

    $ conda update -n base -c conda-forge conda



# All requested packages already installed.

+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/bins_env -c conda-forge -c bioconda 'python=3.8.15' 'python=3.8.15' 'oarfish=0.6.2' 'minimap2=2.28' 'samtools=1.21' 'k8=1.2' --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done


==> WARNING: A newer version of conda exists. <==
    current version: 24.3.0
    latest version: 24.9.2

Please update conda by running

    $ conda update -n base -c conda-forge conda



## Package Plan ##

  environment location: /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/bins_env

  added / updated specs:
    - k8=1.2
    - minimap2=2.28
    - oarfish=0.6.2
    - python[version='3.8.15.*,3.8.15.*']
    - samtools=1.21


The following NEW packages will be INSTALLED:

  c-ares             conda-forge/linux-aarch64::c-ares-1.34.2-ha64f414_0 
  htslib             bioconda/linux-aarch64::htslib-1.21-h3b4eab8_0 
  k8                 bioconda/linux-aarch64::k8-1.2-h7f4e536_2 
  keyutils           conda-forge/linux-aarch64::keyutils-1.6.1-h4e544f5_0 
  krb5               conda-forge/linux-aarch64::krb5-1.21.3-h50a48e9_0 
  libcurl            conda-forge/linux-aarch64::libcurl-8.10.1-h3ec0cbf_0 
  libdeflate         conda-forge/linux-aarch64::libdeflate-1.20-h31becfc_0 
  libedit            conda-forge/linux-aarch64::libedit-3.1.20191231-he28a2e2_2 
  libev              conda-forge/linux-aarch64::libev-4.33-h31becfc_2 
  libnghttp2         conda-forge/linux-aarch64::libnghttp2-1.58.0-hb0e430d_1 
  libssh2            conda-forge/linux-aarch64::libssh2-1.11.0-h492db2e_0 
  libstdcxx          conda-forge/linux-aarch64::libstdcxx-14.2.0-h3f4de04_1 
  libstdcxx-ng       conda-forge/linux-aarch64::libstdcxx-ng-14.2.0-hf1166c9_1 
  minimap2           bioconda/linux-aarch64::minimap2-2.28-h73052cd_3 
  oarfish            bioconda/linux-aarch64::oarfish-0.6.2-h42e9ff9_0 
  python_abi         conda-forge/linux-aarch64::python_abi-3.8-5_cp38 
  samtools           bioconda/linux-aarch64::samtools-1.21-h7a5d460_0 
  zlib               conda-forge/linux-aarch64::zlib-1.3.1-h86ecc28_2 
  zstd               conda-forge/linux-aarch64::zstd-1.5.6-h02f22dd_0 



Downloading and Extracting Packages: ...working... done
Preparing transaction: ...working... done
Verifying transaction: ...working... done
Executing transaction: ...working... done
[M::mm_idx_gen::0.016*1.09] collected minimizers
[M::mm_idx_gen::0.028*1.05] sorted minimizers
[M::main::0.028*1.05] loaded/built the index for 7 target sequence(s)
[M::mm_mapopt_update::0.031*1.04] mid_occ = 14
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7
[M::mm_idx_stat::0.033*1.04] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947
[M::worker_pipeline::8.806*0.99] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/32cdef70798944_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef5b77baf6_sample1.fastq.gz
[M::main] Real time: 8.813 sec; CPU: 8.696 sec; Peak RSS: 0.081 GB
	Aligning sample  32cdef7841c572_sample2 ...
05:43:05 Sat Oct 19 2024 minimap2_align
[M::mm_idx_gen::0.015*1.07] collected minimizers
[M::mm_idx_gen::0.025*1.04] sorted minimizers
[M::main::0.025*1.04] loaded/built the index for 7 target sequence(s)
[M::mm_mapopt_update::0.028*1.04] mid_occ = 14
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7
[M::mm_idx_stat::0.029*1.04] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947
[M::worker_pipeline::8.879*0.99] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/32cdef70798944_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef7841c572_sample2.fastq.gz
[M::main] Real time: 8.885 sec; CPU: 8.786 sec; Peak RSS: 0.096 GB
05:43:15 Sat Oct 19 2024 find_isoform
Warning in check_forbidden_install("Python packages") :
  cannot install Python packages during R CMD check
Warning in check_forbidden_install("Conda Environments") :
  cannot install Conda Environments during R CMD check
+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda create --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env 'python=3.11.9' --quiet -c conda-forge -c bioconda --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done

## Package Plan ##

  environment location: /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env

  added / updated specs:
    - python=3.11.9


The following NEW packages will be INSTALLED:

  _openmp_mutex      conda-forge/linux-aarch64::_openmp_mutex-4.5-2_gnu 
  bzip2              conda-forge/linux-aarch64::bzip2-1.0.8-h68df207_7 
  ca-certificates    conda-forge/linux-aarch64::ca-certificates-2024.8.30-hcefe29a_0 
  ld_impl_linux-aar~ conda-forge/linux-aarch64::ld_impl_linux-aarch64-2.43-h80caac9_1 
  libexpat           conda-forge/linux-aarch64::libexpat-2.6.3-h5ad3122_0 
  libffi             conda-forge/linux-aarch64::libffi-3.4.2-h3557bc0_5 
  libgcc             conda-forge/linux-aarch64::libgcc-14.2.0-he277a41_1 
  libgcc-ng          conda-forge/linux-aarch64::libgcc-ng-14.2.0-he9431aa_1 
  libgomp            conda-forge/linux-aarch64::libgomp-14.2.0-he277a41_1 
  libnsl             conda-forge/linux-aarch64::libnsl-2.0.1-h31becfc_0 
  libsqlite          conda-forge/linux-aarch64::libsqlite-3.46.1-hc4a20ef_0 
  libuuid            conda-forge/linux-aarch64::libuuid-2.38.1-hb4cce97_0 
  libxcrypt          conda-forge/linux-aarch64::libxcrypt-4.4.36-h31becfc_1 
  libzlib            conda-forge/linux-aarch64::libzlib-1.3.1-h86ecc28_2 
  ncurses            conda-forge/linux-aarch64::ncurses-6.5-hcccb83c_1 
  openssl            conda-forge/linux-aarch64::openssl-3.3.2-h86ecc28_0 
  pip                conda-forge/noarch::pip-24.2-pyh8b19718_1 
  python             conda-forge/linux-aarch64::python-3.11.9-hddfb980_0_cpython 
  readline           conda-forge/linux-aarch64::readline-8.2-h8fc344f_1 
  setuptools         conda-forge/noarch::setuptools-75.1.0-pyhd8ed1ab_0 
  tk                 conda-forge/linux-aarch64::tk-8.6.13-h194ca79_0 
  tzdata             conda-forge/noarch::tzdata-2024b-hc8b5060_0 
  wheel              conda-forge/noarch::wheel-0.44.0-pyhd8ed1ab_0 
  xz                 conda-forge/linux-aarch64::xz-5.2.6-h9cdd2b7_0 


Preparing transaction: ...working... done
Verifying transaction: ...working... done
Executing transaction: ...working... done
+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env 'python=3.11.9' -c conda-forge -c bioconda --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done


==> WARNING: A newer version of conda exists. <==
    current version: 24.3.0
    latest version: 24.9.2

Please update conda by running

    $ conda update -n base -c conda-forge conda



# All requested packages already installed.

+ /home/biocbuild/.cache/R/basilisk/1.17.2/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env -c conda-forge -c bioconda 'python=3.11.9' 'python=3.11.9' 'numpy=2.1.1' 'scipy=1.14.1' 'pysam=0.22.1' 'cutadapt=4.9' 'tqdm=4.66.5' 'pandas=2.2.3' --override-channels
Channels:
 - conda-forge
 - bioconda
Platform: linux-aarch64
Collecting package metadata (repodata.json): ...working... done
Solving environment: ...working... done


==> WARNING: A newer version of conda exists. <==
    current version: 24.3.0
    latest version: 24.9.2

Please update conda by running

    $ conda update -n base -c conda-forge conda



## Package Plan ##

  environment location: /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env

  added / updated specs:
    - cutadapt=4.9
    - numpy=2.1.1
    - pandas=2.2.3
    - pysam=0.22.1
    - python[version='3.11.9.*,3.11.9.*']
    - scipy=1.14.1
    - tqdm=4.66.5


The following NEW packages will be INSTALLED:

  c-ares             conda-forge/linux-aarch64::c-ares-1.34.2-ha64f414_0 
  cffi               conda-forge/linux-aarch64::cffi-1.17.1-py311h14e8bb7_0 
  colorama           conda-forge/noarch::colorama-0.4.6-pyhd8ed1ab_0 
  cutadapt           bioconda/linux-aarch64::cutadapt-4.9-py311h9d58220_2 
  dnaio              bioconda/linux-aarch64::dnaio-1.2.2-py311h9d58220_0 
  isa-l              conda-forge/linux-aarch64::isa-l-2.31.0-h68df207_2 
  keyutils           conda-forge/linux-aarch64::keyutils-1.6.1-h4e544f5_0 
  krb5               conda-forge/linux-aarch64::krb5-1.21.3-h50a48e9_0 
  libblas            conda-forge/linux-aarch64::libblas-3.9.0-24_linuxaarch64_openblas 
  libcblas           conda-forge/linux-aarch64::libcblas-3.9.0-24_linuxaarch64_openblas 
  libcurl            conda-forge/linux-aarch64::libcurl-8.10.1-h3ec0cbf_0 
  libdeflate         conda-forge/linux-aarch64::libdeflate-1.20-h31becfc_0 
  libedit            conda-forge/linux-aarch64::libedit-3.1.20191231-he28a2e2_2 
  libev              conda-forge/linux-aarch64::libev-4.33-h31becfc_2 
  libgfortran        conda-forge/linux-aarch64::libgfortran-14.2.0-he9431aa_1 
  libgfortran-ng     conda-forge/linux-aarch64::libgfortran-ng-14.2.0-he9431aa_1 
  libgfortran5       conda-forge/linux-aarch64::libgfortran5-14.2.0-hb6113d0_1 
  liblapack          conda-forge/linux-aarch64::liblapack-3.9.0-24_linuxaarch64_openblas 
  libnghttp2         conda-forge/linux-aarch64::libnghttp2-1.58.0-hb0e430d_1 
  libopenblas        conda-forge/linux-aarch64::libopenblas-0.3.27-pthreads_h076ed1e_1 
  libssh2            conda-forge/linux-aarch64::libssh2-1.11.0-h492db2e_0 
  libstdcxx          conda-forge/linux-aarch64::libstdcxx-14.2.0-h3f4de04_1 
  libstdcxx-ng       conda-forge/linux-aarch64::libstdcxx-ng-14.2.0-hf1166c9_1 
  numpy              conda-forge/linux-aarch64::numpy-2.1.1-py311he9aa9f1_0 
  pandas             conda-forge/linux-aarch64::pandas-2.2.3-py311h848c333_1 
  pbzip2             conda-forge/linux-aarch64::pbzip2-1.1.13-ha36d286_2 
  pigz               conda-forge/linux-aarch64::pigz-2.8-h194ca79_0 
  pycparser          conda-forge/noarch::pycparser-2.22-pyhd8ed1ab_0 
  pysam              bioconda/linux-aarch64::pysam-0.22.1-py311h90abb8a_2 
  python-dateutil    conda-forge/noarch::python-dateutil-2.9.0-pyhd8ed1ab_0 
  python-isal        conda-forge/linux-aarch64::python-isal-1.7.1-py311ha879c10_0 
  python-tzdata      conda-forge/noarch::python-tzdata-2024.2-pyhd8ed1ab_0 
  python-zlib-ng     conda-forge/linux-aarch64::python-zlib-ng-0.5.1-py311hbded170_0 
  python_abi         conda-forge/linux-aarch64::python_abi-3.11-5_cp311 
  pytz               conda-forge/noarch::pytz-2024.1-pyhd8ed1ab_0 
  scipy              conda-forge/linux-aarch64::scipy-1.14.1-py311h74f25a6_0 
  six                conda-forge/noarch::six-1.16.0-pyh6c4a22f_0 
  tqdm               conda-forge/noarch::tqdm-4.66.5-pyhd8ed1ab_0 
  xopen              conda-forge/noarch::xopen-2.0.2-pyh707e725_1 
  zlib-ng            conda-forge/linux-aarch64::zlib-ng-2.2.2-h5ad3122_0 
  zstandard          conda-forge/linux-aarch64::zstandard-0.23.0-py311hd5293d8_1 
  zstd               conda-forge/linux-aarch64::zstd-1.5.6-h02f22dd_0 



Downloading and Extracting Packages: ...working... done
Preparing transaction: ...working... done
Verifying transaction: ...working... done
Executing transaction: ...working... done
Collecting fast-edit-distance==1.2.2
  Using cached fast_edit_distance-1.2.2-cp311-cp311-linux_aarch64.whl
Collecting blaze2==2.5.*
  Using cached blaze2-2.5.0-py3-none-any.whl.metadata (13 kB)
Collecting matplotlib==3.9.1
  Using cached matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (11 kB)
Collecting cython (from fast-edit-distance==1.2.2)
  Using cached Cython-3.0.11-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (3.2 kB)
Requirement already satisfied: tqdm in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from blaze2==2.5.*) (4.66.5)
Requirement already satisfied: numpy in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from blaze2==2.5.*) (2.1.1)
Requirement already satisfied: pandas in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from blaze2==2.5.*) (2.2.3)
Collecting contourpy>=1.0.1 (from matplotlib==3.9.1)
  Using cached contourpy-1.3.0-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (5.4 kB)
Collecting cycler>=0.10 (from matplotlib==3.9.1)
  Using cached cycler-0.12.1-py3-none-any.whl.metadata (3.8 kB)
Collecting fonttools>=4.22.0 (from matplotlib==3.9.1)
  Using cached fonttools-4.54.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (163 kB)
Collecting kiwisolver>=1.3.1 (from matplotlib==3.9.1)
  Using cached kiwisolver-1.4.7-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (6.3 kB)
Collecting packaging>=20.0 (from matplotlib==3.9.1)
  Using cached packaging-24.1-py3-none-any.whl.metadata (3.2 kB)
Collecting pillow>=8 (from matplotlib==3.9.1)
  Using cached pillow-11.0.0-cp311-cp311-manylinux_2_28_aarch64.whl.metadata (9.1 kB)
Collecting pyparsing>=2.3.1 (from matplotlib==3.9.1)
  Using cached pyparsing-3.2.0-py3-none-any.whl.metadata (5.0 kB)
Requirement already satisfied: python-dateutil>=2.7 in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from matplotlib==3.9.1) (2.9.0)
Requirement already satisfied: six>=1.5 in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from python-dateutil>=2.7->matplotlib==3.9.1) (1.16.0)
Requirement already satisfied: pytz>=2020.1 in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from pandas->blaze2==2.5.*) (2024.1)
Requirement already satisfied: tzdata>=2022.7 in /home/biocbuild/.cache/R/basilisk/1.17.2/FLAMES/1.99.0/flames_env/lib/python3.11/site-packages (from pandas->blaze2==2.5.*) (2024.2)
WARNING: The candidate selected for download or install is a yanked version: 'matplotlib' candidate (version 3.9.1 at https://files.pythonhosted.org/packages/54/7e/4f8f44fcc65a8cfa6303d3469d8973d6a2ba019a9627af9a9ae545f718d6/matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (from https://pypi.org/simple/matplotlib/) (requires-python:>=3.9))
Reason for being yanked: The Windows wheels, under some conditions, caused segfaults in unrelated user code.  Due to this we deleted the Windows wheels to prevent these segfaults, however this caused greater disruption as pip then began to try (and fail) to build 3.9.1 from the sdist on Windows which impacted far more users.  Yanking the whole release is the only tool available to eliminate these failures without changes to on the user side.  The sdist, OSX wheel, and manylinux wheels are all functional and there are no critical bugs in the release.   Downstream packagers should not yank their builds of Matplotlib 3.9.1.  See https://github.com/matplotlib/matplotlib/issues/28551 for details.
Using cached blaze2-2.5.0-py3-none-any.whl (45.7 MB)
Using cached matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (8.2 MB)
Using cached contourpy-1.3.0-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (310 kB)
Using cached cycler-0.12.1-py3-none-any.whl (8.3 kB)
Using cached fonttools-4.54.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (4.9 MB)
Using cached kiwisolver-1.4.7-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (1.4 MB)
Using cached packaging-24.1-py3-none-any.whl (53 kB)
Using cached pillow-11.0.0-cp311-cp311-manylinux_2_28_aarch64.whl (4.2 MB)
Using cached pyparsing-3.2.0-py3-none-any.whl (106 kB)
Using cached Cython-3.0.11-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (3.4 MB)
Installing collected packages: pyparsing, pillow, packaging, kiwisolver, fonttools, cython, cycler, contourpy, matplotlib, fast-edit-distance, blaze2
Successfully installed blaze2-2.5.0 contourpy-1.3.0 cycler-0.12.1 cython-3.0.11 fast-edit-distance-1.2.2 fonttools-4.54.1 kiwisolver-1.4.7 matplotlib-3.9.1 packaging-24.1 pillow-11.0.0 pyparsing-3.2.0
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter({'duplicated_transcripts': 2})
#### find isoforms
SIRV1
SIRV2
SIRV3
SIRV4
SIRV5
SIRV6
SIRV7
#### Realign to transcript using minimap2
	Realigning sample  32cdef5b77baf6_sample1 ...
05:44:37 Sat Oct 19 2024 minimap2_realign
[M::mm_idx_gen::0.004*1.44] collected minimizers
[M::mm_idx_gen::0.007*1.91] sorted minimizers
[M::main::0.007*1.91] loaded/built the index for 75 target sequence(s)
[M::mm_mapopt_update::0.008*1.83] mid_occ = 17
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 75
[M::mm_idx_stat::0.008*1.79] distinct minimizers: 4774 (32.72% are singletons); average occurrences: 3.060; average spacing: 5.390
[M::worker_pipeline::1.226*2.52] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/transcript_assembly.fa /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef5b77baf6_sample1.fastq.gz
[M::main] Real time: 1.228 sec; CPU: 3.097 sec; Peak RSS: 0.029 GB
file renamed to  32cdef5b77baf6_sample1_realign2transcript.bam 
Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) :
  cannot remove file '/home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/32cdef5b77baf6_sample1_tmp_align.bam', reason 'No such file or directory'
	Realigning sample  32cdef7841c572_sample2 ...
05:44:38 Sat Oct 19 2024 minimap2_realign
[M::mm_idx_gen::0.004*1.46] collected minimizers
[M::mm_idx_gen::0.007*2.00] sorted minimizers
[M::main::0.007*2.00] loaded/built the index for 75 target sequence(s)
[M::mm_mapopt_update::0.007*1.92] mid_occ = 17
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 75
[M::mm_idx_stat::0.008*1.88] distinct minimizers: 4774 (32.72% are singletons); average occurrences: 3.060; average spacing: 5.390
[M::worker_pipeline::0.901*2.50] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/transcript_assembly.fa /home/biocbuild/tmp/RtmpAbKeWU/file32cdef740e51ce/fastq_dir/32cdef7841c572_sample2.fastq.gz
[M::main] Real time: 0.904 sec; CPU: 2.260 sec; Peak RSS: 0.026 GB
file renamed to  32cdef7841c572_sample2_realign2transcript.bam 
Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) :
  cannot remove file '/home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/32cdef7841c572_sample2_tmp_align.bam', reason 'No such file or directory'
#### Generating transcript count matrix
2024-10-19T05:44:39.361167Z  INFO oarfish: setting user-provided filter parameters.
2024-10-19T05:44:39.363374Z  INFO oarfish::alignment_parser: read header from BAM file /home/biocbuild/tmp/RtmpAbKeWU/file32cdef76a1d7f6/32cdef5b77baf6_sample1_realign2transcript.bam, contains 75 reference sequences.
thread 'main' panicked at src/alignment_parser.rs:29:10:
has inner header
note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace
Error in run_oarfish(realign_bam, outdir, threads = config$pipeline_parameters$threads,  : 
  error running oarfish:
134
Calls: bulk_long_pipeline ... quantify_transcript -> quantify_transcript_oarfish -> run_oarfish
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 6 NOTEs
See
  ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.4.1/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (GCC) 10.3.1’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |  for (int i = 0; i < s.size(); i++) {
      |                  ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |  for (int i = 0; i < s.size(); i++) {
      |                  ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |  for (int i = 0; i < s.size(); i++) {
      |                  ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:21: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |   if (blocks.size() >= (int)this->Min_sup_cnt) {
      |       ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:26: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |  if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |       ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:24: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |   (right_counts.size() < (int)this->Min_sup_cnt)) {
      |    ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |     for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                     ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:22: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |    for (int i = 0; i < new_exons.size(); ++i) {
      |                    ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:18: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |     } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:22: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |    for (int i = 0; i < exons.size(); i+=2) {
      |                    ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |  for (int i = 0; i < s.size(); i++) {
      |                  ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:122:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  122 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::string get_umi(const string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’:
main-functions/flexiplex.cpp:163:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  163 |     if (seq.length() < umi_start + umi_length) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:187:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  187 |     if (read_to_subpatterns.size() > umi_index + 1) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:295:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  295 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:354:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  354 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  356 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:357:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  357 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:396:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  396 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’:
main-functions/flexiplex.cpp:421:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  421 |                << (barcode.flank_end == std::string::npos ? "True" : "False")
      |                    ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’:
main-functions/flexiplex.cpp:453:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  453 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:468:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  468 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  473 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’:
main-functions/flexiplex.cpp:730:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  730 |       for (int t = 0; t < sr_v.size();
      |                       ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:735:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  735 |         for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                         ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:737:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  737 |           for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:739:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  739 |           for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const string&, const string&, const string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
main-functions/../utility/utility.h:255:20: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |  for (int i = 0; i < s.size(); i++) {
      |                  ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -I"/home/biocbuild/R/R-4.4.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4.1/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/R/R-4.4.1/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/R/R-4.4.1/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/R/R-4.4.1/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/R/R-4.4.1/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.4.1 (2024-06-14) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /home/biocbuild/tmp/RtmpQ7EwBv/file33036632d43d76/config_file_3343206.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file3303662885c68d/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.4.1/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file33036634f543eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.4.1/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file33036634f543eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file3303664215357d/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file3303664215357d/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file3303664215357d/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file3303664215357d/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file33036677f05a8b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.4.1/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file33036677f05a8b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file33036673efeff6/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file33036673efeff6/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file33036673efeff6/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQ7EwBv/file33036673efeff6/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file33036677f05a8b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.4.1/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQ7EwBv/file3303664d00ecd1/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.4.1/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 28.636   1.119  29.768

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
annotation_to_fasta1.7300.0551.791
blaze0.3770.0442.750