##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD check --install=check:alabaster.files.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings alabaster.files_1.5.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/alabaster.files.Rcheck’
* using R Under development (unstable) (2024-11-24 r87369)
* using platform: aarch64-unknown-linux-gnu
* R was compiled by
    aarch64-unknown-linux-gnu-gcc (GCC) 14.2.0
    GNU Fortran (GCC) 14.2.0
* running under: openEuler 24.03 (LTS)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘alabaster.files/DESCRIPTION’ ... OK
* this is package ‘alabaster.files’ version ‘1.5.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘alabaster.files’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
License stub is invalid DCF.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  BamFileReference.Rd: saveObject
  BcfFileReference.Rd: saveObject
  BedFileReference.Rd: saveObject
  BgzipIndexWrapper.Rd: stageObject
  BigBedFileReference.Rd: stageObject
  BigWigFileReference.Rd: stageObject
  FastaFileReference.Rd: saveObject
  FastqFileReference.Rd: saveObject
  GffFileReference.Rd: saveObject
  GmtFileReference.Rd: stageObject
  TabixIndexWrapper.Rd: stageObject
  virtual-wrapper.Rd: Annotated-class, metadata
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘alabaster.files-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: BgzipIndexWrapper
> ### Title: Wrapper for a Bgzip index file
> ### Aliases: BgzipIndexWrapper BgzipIndexWrapper-class
> ###   stageObject,BgzipIndexWrapper-method loadBgzipIndexWrapper
> 
> ### ** Examples
> 
> # Mocking up a FASTA index file.
> input <- system.file("extdata", "ce2dict1.fa", package="Rsamtools")
> temp <- tempfile(fileext=".fa.bgz")
> copy <- Rsamtools::bgzip(input, dest=temp)
> Rsamtools::indexFa(copy)
[1] "/home/biocbuild/tmp/Rtmp1k9ris/file1861e46b520697.fa.bgz.fai"
> 
> # Creating a BgzipIndexWrapper.
> wrapped <- BgzipIndexWrapper(paste0(copy, ".gzi"))
> wrapped
BgzipIndexWrapper object
path: /home/biocbuild/tmp/Rtmp1k9ris/file1861e46b520697.fa.bgz.gzi 
metadata(0):
> 
> # Staging the BgzipIndexWrapper.
> dir <- tempfile()
> library(alabaster.base)
> info <- stageObject(wrapped, dir, "tab")
> invisible(.writeMetadata(info, dir))
Error in dyn.load(file, DLLpath = DLLpath, ...) : 
  unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Calls: .writeMetadata ... jsonvalidate_js -> loadNamespace -> library.dynam -> dyn.load
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 ERROR
Running the tests in ‘tests/testthat.R’ failed.
Last 13 lines of output:
    3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
    4. │   └─alabaster.files:::save_compressed_indexed_wrapper(...)
    5. │     └─alabaster.files:::stage_with_index(...)
    6. │       └─alabaster.base::.writeMetadata(imeta, dir)
    7. │         └─alabaster.base::writeMetadata(...)
    8. │           └─jsonvalidate::json_validate(...)
    9. │             └─jsonvalidate::json_validator(...)
   10. │               └─jsonvalidate:::jsonvalidate_js()
   11. └─base::loadNamespace(x)
   12.   └─base::library.dynam(lib, package, package.lib)
   13.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
  
  [ FAIL 16 | WARN 0 | SKIP 0 | PASS 85 ]
  Error: Test failures
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 2 NOTEs
See
  ‘/home/biocbuild/bbs-3.21-bioc/meat/alabaster.files.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD INSTALL alabaster.files
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library’
* installing *source* package ‘alabaster.files’ ...
** using staged installation
** R
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (alabaster.files)

R Under development (unstable) (2024-11-24 r87369) -- "Unsuffered Consequences"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(alabaster.files)
Loading required package: alabaster.base
> test_check("alabaster.files")
[E::get_intv] Failed to parse TBX_GENERIC, was wrong -p [type] used?
The offending line was: ">"
[E::get_intv] Failed to parse TBX_GENERIC, was wrong -p [type] used?
The offending line was: "ACCCTGACTCCAGGATTACA"
[E::get_intv] Failed to parse TBX_GENERIC, was wrong -p [type] used?
The offending line was: ">"
[E::get_intv] Failed to parse TBX_GENERIC, was wrong -p [type] used?
The offending line was: "ACCCTGACTCCAGGATTACA"
[W::tbx_parse1] VCF INFO/END=2827680 is smaller than POS at 1:2827692
This tag will be ignored. Note: only one invalid END tag will be reported.
[ FAIL 16 | WARN 0 | SKIP 0 | PASS 85 ]

══ Failed tests ════════════════════════════════════════════════════════════════
── Error ('test-BamWrapper.R:15:5'): BAM wrapper works correctly ───────────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<BamWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bam") at test-BamWrapper.R:15:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_bam")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_indexed_wrapper(...)
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-BamWrapper.R:38:5'): BAM wrapper with index works correctly ────
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bam") at test-BamWrapper.R:38:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_bam")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_indexed_wrapper(...)
  5. │     └─alabaster.files:::stage_with_index(...)
  6. │       └─alabaster.base::.writeMetadata(imeta, dir)
  7. │         └─alabaster.base::writeMetadata(...)
  8. │           └─jsonvalidate::json_validate(...)
  9. │             └─jsonvalidate::json_validator(...)
 10. │               └─jsonvalidate:::jsonvalidate_js()
 11. └─base::loadNamespace(x)
 12.   └─base::library.dynam(lib, package, package.lib)
 13.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-BedWrapper.R:17:5'): BED wrapper works correctly ───────────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<BedWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bed") at test-BedWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_bed")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-BedWrapper.R:59:5'): BED wrapper with index works correctly ────
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bed") at test-BedWrapper.R:59:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_bed")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5. │     └─alabaster.files:::stage_with_index(...)
  6. │       └─alabaster.base::.writeMetadata(imeta, dir)
  7. │         └─alabaster.base::writeMetadata(...)
  8. │           └─jsonvalidate::json_validate(...)
  9. │             └─jsonvalidate::json_validator(...)
 10. │               └─jsonvalidate:::jsonvalidate_js()
 11. └─base::loadNamespace(x)
 12.   └─base::library.dynam(lib, package, package.lib)
 13.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-BigBedWrapper.R:15:5'): BigBed wrapper works correctly ─────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<BigBedWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bb") at test-BigBedWrapper.R:15:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_bb")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_wrapper(x, dir, path, fname = "file.bb")
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-BigWigWrapper.R:15:5'): bigWig wrapper works correctly ─────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<BigWigWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_bw") at test-BigWigWrapper.R:15:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_bw")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_wrapper(x, dir, path, fname = "file.bw")
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-FastaWrapper.R:17:5'): FASTA wrapper works correctly ───────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<FastaWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_fa") at test-FastaWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_fa")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_fa_wrapper(...)
  5.       └─alabaster.files:::save_compressed_indexed_wrapper(...)
  6.         └─alabaster.base::.processMetadata(x, dir, path, "other")
  7.           └─alabaster.base::processMetadata(...)
  8.             └─base::tryCatch(...)
  9.               └─base (local) tryCatchList(expr, classes, parentenv, handlers)
 10.                 └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 11.                   └─value[[3L]](cond)
── Error ('test-FastaWrapper.R:62:5'): FASTA wrapper with index works correctly without compression ──
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_fa") at test-FastaWrapper.R:62:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_fa")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_fa_wrapper(...)
  5. │     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  6. │       └─alabaster.files:::stage_with_index(...)
  7. │         └─alabaster.base::.writeMetadata(imeta, dir)
  8. │           └─alabaster.base::writeMetadata(...)
  9. │             └─jsonvalidate::json_validate(...)
 10. │               └─jsonvalidate::json_validator(...)
 11. │                 └─jsonvalidate:::jsonvalidate_js()
 12. └─base::loadNamespace(x)
 13.   └─base::library.dynam(lib, package, package.lib)
 14.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-FastaWrapper.R:91:5'): FASTA wrapper with index works correctly with compression ──
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_fa") at test-FastaWrapper.R:91:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_fa")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_fa_wrapper(...)
  5. │     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  6. │       └─alabaster.files:::stage_with_index(...)
  7. │         └─alabaster.base::.writeMetadata(imeta, dir)
  8. │           └─alabaster.base::writeMetadata(...)
  9. │             └─jsonvalidate::json_validate(...)
 10. │               └─jsonvalidate::json_validator(...)
 11. │                 └─jsonvalidate:::jsonvalidate_js()
 12. └─base::loadNamespace(x)
 13.   └─base::library.dynam(lib, package, package.lib)
 14.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-FastqWrapper.R:17:5'): FASTQ wrapper works correctly ───────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<FastqWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_fastq") at test-FastqWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_fastq")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_fa_wrapper(...)
  5.       └─alabaster.files:::save_compressed_indexed_wrapper(...)
  6.         └─alabaster.base::.processMetadata(x, dir, path, "other")
  7.           └─alabaster.base::processMetadata(...)
  8.             └─base::tryCatch(...)
  9.               └─base (local) tryCatchList(expr, classes, parentenv, handlers)
 10.                 └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 11.                   └─value[[3L]](cond)
── Error ('test-FastqWrapper.R:59:5'): FASTQ wrapper with index works correctly ──
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_fastq") at test-FastqWrapper.R:59:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_fastq")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_fa_wrapper(...)
  5. │     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  6. │       └─alabaster.files:::stage_with_index(...)
  7. │         └─alabaster.base::.writeMetadata(imeta, dir)
  8. │           └─alabaster.base::writeMetadata(...)
  9. │             └─jsonvalidate::json_validate(...)
 10. │               └─jsonvalidate::json_validator(...)
 11. │                 └─jsonvalidate:::jsonvalidate_js()
 12. └─base::loadNamespace(x)
 13.   └─base::library.dynam(lib, package, package.lib)
 14.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-GffWrapper.R:17:5'): GFF wrapper works correctly ───────────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<GffWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_gff") at test-GffWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_gff")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-GffWrapper.R:60:5'): GFF wrapper with index works correctly ────
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_gff") at test-GffWrapper.R:60:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_gff")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5. │     └─alabaster.files:::stage_with_index(...)
  6. │       └─alabaster.base::.writeMetadata(imeta, dir)
  7. │         └─alabaster.base::writeMetadata(...)
  8. │           └─jsonvalidate::json_validate(...)
  9. │             └─jsonvalidate::json_validator(...)
 10. │               └─jsonvalidate:::jsonvalidate_js()
 11. └─base::loadNamespace(x)
 12.   └─base::library.dynam(lib, package, package.lib)
 13.     └─base::dyn.load(file, DLLpath = DLLpath, ...)
── Error ('test-GmtWrapper.R:17:5'): GMT wrapper works correctly ───────────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<GmtWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_gmt") at test-GmtWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_gmt")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_compressed_wrapper(x, dir, path, fname = "file.gmt")
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-VcfWrapper.R:17:5'): VCF wrapper works correctly ───────────────
Error in `value[[3L]](cond)`: failed to stage 'metadata(<VcfWrapper>)'
  - unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_vcf") at test-VcfWrapper.R:17:5
  2. └─alabaster.files::stageObject(wrapped, dir, "my_vcf")
  3.   └─alabaster.files (local) .local(x, dir, path, child, ...)
  4.     └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5.       └─alabaster.base::.processMetadata(x, dir, path, "other")
  6.         └─alabaster.base::processMetadata(...)
  7.           └─base::tryCatch(...)
  8.             └─base (local) tryCatchList(expr, classes, parentenv, handlers)
  9.               └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
 10.                 └─value[[3L]](cond)
── Error ('test-VcfWrapper.R:60:5'): VCF wrapper with index works correctly ────
Error in `dyn.load(file, DLLpath = DLLpath, ...)`: unable to load shared object '/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/V8/libs/V8.so':
  libnode.so.72: cannot open shared object file: No such file or directory
Backtrace:
     ▆
  1. ├─alabaster.base::stageObject(wrapped, dir, "my_vcf") at test-VcfWrapper.R:60:5
  2. ├─alabaster.files::stageObject(wrapped, dir, "my_vcf")
  3. │ └─alabaster.files (local) .local(x, dir, path, child, ...)
  4. │   └─alabaster.files:::save_compressed_indexed_wrapper(...)
  5. │     └─alabaster.files:::stage_with_index(...)
  6. │       └─alabaster.base::.writeMetadata(imeta, dir)
  7. │         └─alabaster.base::writeMetadata(...)
  8. │           └─jsonvalidate::json_validate(...)
  9. │             └─jsonvalidate::json_validator(...)
 10. │               └─jsonvalidate:::jsonvalidate_js()
 11. └─base::loadNamespace(x)
 12.   └─base::library.dynam(lib, package, package.lib)
 13.     └─base::dyn.load(file, DLLpath = DLLpath, ...)

[ FAIL 16 | WARN 0 | SKIP 0 | PASS 85 ]
Error: Test failures
Execution halted