Package: trena

Version: 1.0.3

Command: /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --no-vignettes --timings trena_1.0.3.tar.gz

StartedAt: 2018-04-12 10:29:14 -0400 (Thu, 12 Apr 2018)

EndedAt: 2018-04-12 10:43:32 -0400 (Thu, 12 Apr 2018)

EllapsedTime: 858.2 seconds

RetCode: 0

Status:  OK

CheckDir: trena.Rcheck

Warnings: 0

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --no-vignettes --timings trena_1.0.3.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck’
* using R version 3.4.4 (2018-03-15)
* using platform: x86_64-apple-darwin15.6.0 (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘trena/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘trena’ version ‘1.0.3’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘trena’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
.elasticNetSolver: no visible binding for global variable
  ‘cor.target.feature’
assessSnp,Trena: no visible binding for global variable ‘status’
assessSnp,Trena: no visible binding for global variable ‘assessed’
assessSnp,Trena: no visible binding for global variable
  ‘motifRelativeScore’
Undefined global functions or variables:
  assessed cor.target.feature motifRelativeScore status
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking installed files from ‘inst/doc’ ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU or elapsed time > 5s
                       user system elapsed
FootprintFilter-class 0.386  0.011   5.465
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 NOTE
See
  ‘/Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/00check.log’
for details.

* installing *source* package ‘trena’ ...
** R
** inst
** preparing package for lazy loading
See system.file("LICENSE", package="MotifDb") for use restrictions.
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
See system.file("LICENSE", package="MotifDb") for use restrictions.
* DONE (trena)

R version 3.4.4 (2018-03-15) -- "Someone to Lean On"
Copyright (C) 2018 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin15.6.0 (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> require(trena) || stop("unable to load trena Package")
Loading required package: trena
Loading required package: glmnet
Loading required package: Matrix
Loading required package: foreach
Loaded glmnet 2.0-16

Loading required package: MotifDb
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:Matrix':

    colMeans, colSums, rowMeans, rowSums, which

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colMeans, colSums, colnames, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
    pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
    setdiff, sort, table, tapply, union, unique, unsplit, which,
    which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:Matrix':

    expand

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: Biostrings
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

See system.file("LICENSE", package="MotifDb") for use restrictions.

[1] TRUE
> BiocGenerics:::testPackage('trena')
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_CandidateFilter
[1] --- test_CandidateFilter
[1] --- test_EnsembleSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_selectedSolversOnly
[1] --- test_pcaError
[1] --- test_getSolverNames
[1] --- test_oneSolver
[1] --- test_invalidSolvers
[1] --- test_EnsembleSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_getSolverNames
[1] --- test_invalidSolvers
[1] --- test_oneSolver
[1] --- test_pcaError
[1] --- test_selectedSolversOnly
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
Loading required package: DBI
[1] --- test_parseDatabaseUri
[1] --- test_constructor
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_getChromLoc
[1] --- test_getGenePromoterRegion
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getFootprintsForGene
Warning: call dbDisconnect() when finished working with a connection
[1] --- test_constructor
[1] --- test_getChromLoc
[1] --- test_getFootprintsForGene
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getGenePromoterRegion
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_parseDatabaseUri
[1] --- test_directMode
Loading required package: org.Hs.eg.db
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor

    Vignettes contain introductory material; view with
    'browseVignettes()'. To cite Bioconductor, see
    'citation("Biobase")', and for packages 'citation("pkgname")'.

[1] --- test_directMode
[1] --- test_basicConstructor
[1] --- test_getEncodeRegulatoryTableNames
[1] --- test_checkSampleOfEncodeTables
[1] --- wgEncodeRegDnaseUwAg04449Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHmvecdneoPeak: 0 rows
[1] --- wgEncodeRegDnaseUwTh1Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHsmmtubePeak: 0 rows
[1] --- wgEncodeRegDnaseUwHcpepicPeak: 0 rows
[1] --- wgEncodeRegDnaseUwNhaPeak: 0 rows
[1] --- wgEncodeRegDnaseUwNb4Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHmvecdlyadPeak: 0 rows
[1] --- wgEncodeRegDnaseUwBonemarrowmscPeak: 0 rows
[1] --- wgEncodeRegDnaseUwGm06990Peak: 0 rows
[1] --- test_getRegulatoryRegions
[1] --- test_getCandidates.emptyRegion
[1] --- test_getCandidates.vrk2.twoRegions
[1] --- test_getCandidates.vrk2.rs13384219.variant
[1] --- test_basicConstructor
[1] --- test_checkSampleOfEncodeTables
[1] --- test_getCandidates.emptyRegion
[1] --- test_getCandidates.vrk2.rs13384219.variant
[1] --- test_getCandidates.vrk2.twoRegions
[1] --- test_getEncodeRegulatoryTableNames
[1] --- test_getRegulatoryRegions
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_alpha.lasso
[1] --- test_lambda.lasso
[1] --- test_keep.metrics.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.lasso
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_keep.metrics.lasso
[1] --- test_lambda.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_.getScoredMotifs
[1] --- test_.injectSnp
[1] --- test_.matchPwmForwardAndReverse
[1] --- test_basicConstructor
[1] --- test_bugInStartEndOfMinusStrandHits
[1] --- test_findMatchesByChromosomalRegion
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] --- about to check best$seq
$motifName
[1] "Hsapiens-jaspar2016-POU5F1B-MA0792.1"

$chrom
[1] "chr2"

$motifStart
[1] 57907318

$motifEnd
[1] 57907326

$strand
[1] "+"

$motifScore
[1] 6.707832

$motifRelativeScore
[1] 0.9208761

$match
[1] "CATGCAAAT"

$chromStart
[1] 57907313

$chromEnd
[1] 57907333

$seq
[1] "ACCAGCATGCAAATTAGACAA"

$status
[1] "wt"

[1] --- test_findMatchesByChromosomalRegion.twoAlternateAlleles
[1] --- test_findMatchesByChromosomalRegion_contrastReferenceWithVariant
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCGAATTAGACAA    mut
[1] 1 +
[1] 1 -
[1] 1 +
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCGAATTAGACAA    mut
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] --- test_findMatchesByMultipleChromosomalRegions
[1] --- test_getSequence
[1] --- test_getSequenceWithVariants
[1] --- test_noMatch
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_RandomForestSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RandomForestSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_alpha.ridge
[1] --- test_lambda.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.ridge
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_lambda.ridge
[1] --- test_getAssayData
Warning in Solver(mtx, "gene1", c("gene2", "gene3")) :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_getTarget
[1] --- test_getRegulators
[1] --- test_eliminateSelfTFs
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_eliminateSelfTFs
[1] --- test_getAssayData
[1] --- test_getRegulators
[1] --- test_getTarget
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_basicConstructor
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_assessSnp
[1] error, unrecognized variant name: 'rsBogus'
[1] --- test_assessSnp_allTypesWithDeltas
[1] --- test_basicConstructor
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///Users/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_VarianceFilter
[1] --- test_VarianceFilter


RUNIT TEST PROTOCOL -- Thu Apr 12 10:43:24 2018 
*********************************************** 
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 

 
1 Test Suite : 
trena RUnit Tests - 85 test functions, 0 errors, 0 failures
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 
Warning messages:
1: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
2: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
3: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
> 
> proc.time()
   user  system elapsed 
415.884  24.970 533.914 

name	user	system	elapsed
BayesSpikeSolver	0.022	0.001	0.023
CandidateFilter-class	0.001	0.000	0.001
EnsembleSolver	0.009	0.001	0.010
FootprintFilter-class	0.386	0.011	5.465
GeneOntologyFilter-class	0.029	0.001	0.031
HumanDHSFilter-class	0.934	0.008	4.318
LassoPVSolver	0.008	0.001	0.008
LassoSolver	0.008	0.000	0.008
MotifMatcher-class	0.064	0.001	0.065
PearsonSolver	0.008	0.001	0.009
RandomForestSolver	0.008	0.001	0.009
RidgeSolver	0.008	0.001	0.009
Solver-class	0.007	0.001	0.008
SpearmanSolver	0.008	0.001	0.009
SqrtLassoSolver	0.008	0.000	0.009
Trena-class	0.001	0.000	0.000
VarianceFilter-class	0.004	0.000	0.004
assessSnp	0	0	0
createGeneModel	3.378	0.061	4.260
findMatchesByChromosomalRegion	0.001	0.000	0.001
getAssayData	0.010	0.000	0.012
getAvailableSolvers	0.001	0.000	0.000
getCandidates-FootprintFilter-method	0.207	0.008	3.472
getCandidates-GeneOntologyFilter-method	1.017	0.070	1.142
getCandidates-HumanDHSFilter-method	0.001	0.000	0.002
getCandidates-VarianceFilter-method	0.013	0.001	0.014
getChromLoc	0.012	0.001	0.012
getEncodeRegulatoryTableNames-HumanDHSFilter	0.311	0.008	4.658
getFootprintsForGene	0.012	0.000	0.013
getFootprintsInRegion	0.015	0.000	0.015
getGeneModelTableColumnNames	0.001	0.001	0.001
getGenePromoterRegion	0.029	0.000	0.028
getGtfGeneBioTypes	0.011	0.000	0.012
getGtfMoleculeTypes	0.011	0.001	0.012
getPfms	0.204	0.001	0.207
getPromoterRegionsAllGenes	0.159	0.002	0.167
getProximalPromoter	0.092	0.007	3.426
getRegulators	0.010	0.001	0.013
getRegulatoryChromosomalRegions	0.869	0.006	1.654
getRegulatoryRegions	0.001	0.000	0.001
getRegulatoryTableColumnNames	0.001	0.000	0.000
getSequence	0.001	0.000	0.002
getSolverNames	0.008	0.000	0.009
getTarget	0.007	0.001	0.008
parseChromLocString	0.01	0.00	0.01
parseDatabaseUri	0.002	0.001	0.002
rescalePredictorWeights	0.011	0.001	0.013
show-HumanDHSFilter-method	0.241	0.009	4.127
show.BayesSpikeSolver	0.016	0.000	0.016
show.EnsembleSolver	0.008	0.001	0.009
show.LassoPVSolver	0.013	0.001	0.014
show.LassoSolver	0.009	0.002	0.010
show.MotifMatcher	0.012	0.002	0.012
show.PearsonSolver	0.012	0.001	0.013
show.RandomForestSolver	0.018	0.002	0.020
show.RidgeSolver	0.009	0.000	0.009
show.SpearmanSolver	0.016	0.001	0.017
show.SqrtLassoSolver	0.016	0.001	0.017
solve.BayesSpike	0.001	0.000	0.001
solve.Ensemble	0.000	0.000	0.001
solve.Lasso	2.660	0.117	2.832
solve.LassoPV	0.226	0.029	0.258
solve.Pearson	0.026	0.002	0.027
solve.RandomForest	3.110	0.015	3.165
solve.Ridge	4.427	0.149	4.632
solve.Spearman	0.026	0.001	0.032
solve.SqrtLasso	0.001	0.000	0.001