##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings FLAMES_1.8.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.8.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (GCC) 10.3.1’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotation_to_fasta: no visible global function definition for
  'write.table'
generate_sc_sce: no visible binding for global variable 'FSM_match'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
  'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
  'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
  variable 'heatmap_annotation_colors'
sc_umap_expression: no visible binding for global variable
  'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
  'x'
sc_umap_expression : plot_idx: no visible binding for global variable
  'y'
transcript_coverage: no visible binding for global variable 'mat'
Undefined global functions or variables:
  . BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt
  everything gene_id heatmap_annotation_colors label length_bin mat n
  name tr_id transcript transcript_id value write.table x y
Consider adding
  importFrom("utils", "write.table")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘FLAMES-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: bulk_long_pipeline
> ### Title: Pipeline for Bulk Data
> ### Aliases: bulk_long_pipeline
> 
> ### ** Examples
> 
> # download the two fastq files, move them to a folder to be merged together
> temp_path <- tempfile()
> bfc <- BiocFileCache::BiocFileCache(temp_path, ask = FALSE)
> file_url <-
+   "https://raw.githubusercontent.com/OliverVoogd/FLAMESData/master/data"
> # download the required fastq files, and move them to new folder
> fastq1 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq1", paste(file_url, "fastq/sample1.fastq.gz", sep = "/")))]]
> fastq2 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq2", paste(file_url, "fastq/sample2.fastq.gz", sep = "/")))]]
> annotation <- bfc[[names(BiocFileCache::bfcadd(bfc, "annot.gtf", paste(file_url, "SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf", sep = "/")))]]
> genome_fa <- bfc[[names(BiocFileCache::bfcadd(bfc, "genome.fa", paste(file_url, "SIRV_isoforms_multi-fasta_170612a.fasta", sep = "/")))]]
> fastq_dir <- paste(temp_path, "fastq_dir", sep = "/") # the downloaded fastq files need to be in a directory to be merged together
> dir.create(fastq_dir)
> file.copy(c(fastq1, fastq2), fastq_dir)
[1] TRUE TRUE
> unlink(c(fastq1, fastq2)) # the original files can be deleted
> 
> outdir <- tempfile()
> dir.create(outdir)
> if (is.character(locate_minimap2_dir())) {
+   se <- bulk_long_pipeline(
+     annotation = annotation, fastq = fastq_dir, outdir = outdir, genome_fa = genome_fa,
+     config_file = system.file("extdata/SIRV_config_default.json", package = "FLAMES")
+   )
+ 
+   se_2 <- create_se_from_dir(outdir = outdir, annotation = annotation)
+ }
/usr/bin/minimap2
/usr/bin/minimap2
#### Input parameters:
{
  "comment": ["this is the default config for SIRV spike-in data. use splice annotation on alignment."],
  "pipeline_parameters": {
    "seed": [2022],
    "threads": [1],
    "do_barcode_demultiplex": [false],
    "do_gene_quantification": [true],
    "do_genome_alignment": [true],
    "do_isoform_identification": [true],
    "bambu_isoform_identification": [false],
    "do_read_realignment": [true],
    "do_transcript_quantification": [true]
  },
  "barcode_parameters": {
    "max_bc_editdistance": [2],
    "max_flank_editdistance": [8],
    "pattern": {
      "primer": ["CTACACGACGCTCTTCCGATCT"],
      "BC": ["NNNNNNNNNNNNNNNN"],
      "UMI": ["NNNNNNNNNNNN"],
      "polyT": ["TTTTTTTTT"]
    },
    "TSO_seq": ["CCCATGTACTCTGCGTTGATACCACTGCTT"],
    "TSO_prime": [3],
    "full_length_only": [false]
  },
  "isoform_parameters": {
    "generate_raw_isoform": [true],
    "max_dist": [10],
    "max_ts_dist": [100],
    "max_splice_match_dist": [10],
    "min_fl_exon_len": [40],
    "max_site_per_splice": [3],
    "min_sup_cnt": [10],
    "min_cnt_pct": [0.01],
    "min_sup_pct": [0.2],
    "bambu_trust_reference": [true],
    "strand_specific": [1],
    "remove_incomp_reads": [5],
    "downsample_ratio": [1]
  },
  "alignment_parameters": {
    "use_junctions": [true],
    "no_flank": [true]
  },
  "realign_parameters": {
    "use_annotation": [true]
  },
  "transcript_counting": {
    "min_tr_coverage": [0.75],
    "min_read_coverage": [0.75]
  }
} 
gene annotation: /home/biocbuild/tmp/Rtmpg21oWa/file1091117ce668f/10911159b0ded8_SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf 
genome fasta: /home/biocbuild/tmp/Rtmpg21oWa/file1091117ce668f/109111417158e6_SIRV_isoforms_multi-fasta_170612a.fasta 
input fastq files: /home/biocbuild/tmp/Rtmpg21oWa/file1091117ce668f/fastq_dir/10911159b92958_sample2.fastq.gz
 /home/biocbuild/tmp/Rtmpg21oWa/file1091117ce668f/fastq_dir/10911174a45032_sample1.fastq.gz
output directory: /home/biocbuild/tmp/Rtmpg21oWa/file10911117252276 
directory containing minimap2: /usr/bin 
#### Aligning reads to genome using minimap2
	Aligning sample  10911159b92958_sample2 ...
10:46:17 Thu Nov 02 2023 minimap2_align
Error in minimap2_align(config, genome_fa, fastq_files[i], annotation,  : 
  Could not locate k8 and/or paftools.js in the minimap2 folder, they are required for converting annotation to bed12 files
Calls: bulk_long_pipeline -> minimap2_align
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 5 NOTEs
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (GCC) 10.3.1’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.3.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.3.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.3.1/site-library/zlibbioc/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.3.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.3.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.3.1/site-library/zlibbioc/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c flexiplex.cpp -o flexiplex.o
flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’:
flexiplex.cpp:118:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  118 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:224:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  224 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
flexiplex.cpp:285:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  285 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
flexiplex.cpp:287:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  287 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
flexiplex.cpp:288:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  288 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:350:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  350 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’:
flexiplex.cpp:375:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  375 |                << (barcode.flank_end == std::string::npos ? "True" : "False")
      |                    ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool)’:
flexiplex.cpp:400:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  400 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
flexiplex.cpp:410:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  410 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:415:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  415 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘int flexiplex(Rcpp::String, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, int)’:
flexiplex.cpp:634:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  634 |     for (int t = 0; t < sr_v.size();
      |                     ~~^~~~~~~~~~~~~
flexiplex.cpp:639:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  639 |       for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                       ~~^~~~~~~~~~~~~~~~
flexiplex.cpp:641:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  641 |         for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                         ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:643:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  643 |         for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                         ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.3.1/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.3.1/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.3.1/site-library/zlibbioc/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
g++ -std=gnu++17 -shared -L/home/biocbuild/R/R-4.3.1/lib -L/usr/local/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /home/biocbuild/R/R-4.3.1/site-library/Rhtslib/usrlib/libhts.a -lcurl -L/home/biocbuild/R/R-4.3.1/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/R/R-4.3.1/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R version 4.3.1 (2023-06-16) -- "Beagle Scouts"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /home/biocbuild/tmp/RtmpvH9kSS/file10a8a06fe75f72/config_file_1091744.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpvH9kSS/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
> 
> proc.time()
   user  system elapsed 
 26.314   1.336  28.232