--- title: "B.2 -- _Bioconductor_ Building Blocks" author: Martin Morgan
date: "8 - 9 May 2017" output: BiocStyle::html_document2: toc: true toc_depth: 2 vignette: > % \VignetteIndexEntry{B.2 -- Bioconductor Building Blocks} % \VignetteEngine{knitr::rmarkdown} --- ```{r style, echo = FALSE, results = 'asis'} knitr::opts_chunk$set( eval=as.logical(Sys.getenv("KNITR_EVAL", "TRUE")), cache=as.logical(Sys.getenv("KNITR_CACHE", "TRUE"))) ``` ```{r setup, echo=FALSE} suppressPackageStartupMessages({ library(SummarizedExperiment) library(GenomicAlignments) library(AnnotationHub) library(biomaRt) library(airway) library(org.Hs.eg.db) library(TxDb.Hsapiens.UCSC.hg19.knownGene) library(RNAseqData.HNRNPC.bam.chr14) }) ``` # Core infrastructure ## _Biostrings_ DNA, amino acid, and other biological sequences. See earlier example in [B.1 Introduction to _Bioconductor_][]. ## _GRanges_ ### The [GenomicRanges][] package - `GRanges()`: genomic coordinates to represent annotations (exons, genes, regulatory marks, ...) and data (called peaks, variants, aligned reads) ![Alt GRanges](our_figures/GRanges.png) - `GRangesList()`: genomic coordinates grouped into list elements (e.g., paired-end reads; exons grouped by transcript) ![Alt GRangesList](our_figures/GRangesList.png) ### Range operations ![Alt Ranges Algebra](our_figures/RangeOperations.png) #### Ranges - IRanges - `start()` / `end()` / `width()` - List-like -- `length()`, subset, etc. - 'metadata', `mcols()` - GRanges - 'seqnames' (chromosome), 'strand' - `Seqinfo`, including `seqlevels` and `seqlengths` #### Intra-range methods - Independent of other ranges in the same object - GRanges variants strand-aware - `shift()`, `narrow()`, `flank()`, `promoters()`, `resize()`, `restrict()`, `trim()` - See `?"intra-range-methods"` #### Inter-range methods - Depends on other ranges in the same object - `range()`, `reduce()`, `gaps()`, `disjoin()` - `coverage()` (!) - see `?"inter-range-methods"` #### Between-range methods - Functions of two (or more) range objects - `findOverlaps()`, `countOverlaps()`, ..., `%over%`, `%within%`, `%outside%`; `union()`, `intersect()`, `setdiff()`, `punion()`, `pintersect()`, `psetdiff()` #### Example ```{r ranges, message=FALSE} library(GenomicRanges) gr <- GRanges("A", IRanges(c(10, 20, 22), width=5), "+") shift(gr, 1) # intra-range range(gr) # inter-range reduce(gr) # inter-range snps <- GRanges("A", IRanges(c(11, 17, 24), width=1)) findOverlaps(snps, gr) # between-range setdiff(range(gr), gr) # 'introns' ``` ## _GenomicAlignments_ Representation of aligned reads. See exercises below. ## _SummarizedExperiment_ ### The [SummarizedExperiment][] package ![Alt SummarizedExperiment](our_figures/SummarizedExperiment.png) - Coordinate feature x sample 'assays' with row (feature) and column (sample) descriptions. - `colData()` data frame for desciption of samples - `rowRanges()` _GRanges_ / _GRangeList_ or data frame for description of features - `exptData()` to describe the entire object - `assays()` can be any matrix-like object, including very large on-disk representations such as [HDF5Array][] ```{r SummarizedExperiment} library(SummarizedExperiment) library(airway) data(airway) airway colData(airway) airway[, airway$dex %in% "trt"] chr14 <- as(seqinfo(airway), "GRanges")["14"] airway[airway %over% chr14,] ``` ## Annotation Resources - _Bioconductor_ provides extensive access to 'annotation' resources (see the [AnnotationData][] biocViews hierarchy); some interesting examples to explore during this lab include: - [biomaRt][], [PSICQUIC][], [KEGGREST][] and other packages for querying on-line resources; each of these have informative vignettes. - [AnnotationDbi][] is a cornerstone of the [Annotation Data][AnnotationData] packages provided by Bioconductor. - **org** packages (e.g., [org.Hs.eg.db][]) contain maps between different gene identifiers, e.g., ENTREZ and SYMBOL. The basic interface to these packages is described on the help page `?select` - **TxDb** packages (e.g., [TxDb.Hsapiens.UCSC.hg19.knownGene][]) contain gene models (exon coordinates, exon / transcript relationships, etc) derived from common sources such as the hg19 knownGene track of the UCSC genome browser. These packages can be queried, e.g., as described on the `?exonsBy` page to retrieve all exons grouped by gene or transcript. - **BSgenome** packages (e.g., [BSgenome.Hsapiens.UCSC.hg19][]) contain whole genomes of model organisms. - [VariantAnnotation][] and [ensemblVEP][] provide access to sequence annotation facilities, e.g., to identify coding variants; see the [Introduction to VariantAnnotation][] vignette for a brief introduction. - Take a quick look at the [annotation work flow](https://bioconductor.org/help/workflows/annotation/annotation/) on the Bioconductor web site. ### Static packages - _org.\*_: identifier mappings - `select()`, `columns()`, `keys()` - `mapIds()` ```{r} library(org.Hs.eg.db) org <- org.Hs.eg.db select(org, "BRCA1", c("ENSEMBL", "GENENAME"), "SYMBOL") ``` - _TxDb.\*_: gene models - `exons()`, `transcripts()`, `genes()`, `promoters()`, ... - `exonsBy()`, `transcriptsBy()` - `select()`, etc. ```{r} library(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene promoters(txdb) ``` ### Web-based resources - e.g., [biomaRt][], [PSICQUIC][], [GEOquery][], ... ### Genome-scale resources - via [AnnotationHub][] ```{r} library(AnnotationHub) hub = AnnotationHub() hub query(hub, c("ensembl", "81.gtf")) hub[["AH48004"]] ``` # From files to _Bioconductor_ objects ## BED, GFF, GTF, WIG import and export - Genome annotations: BED, WIG, GTF, etc. files. E.g., GTF: - Component coordinates 7 protein_coding gene 27221129 27224842 . - . ... ... 7 protein_coding transcript 27221134 27224835 . - . ... 7 protein_coding exon 27224055 27224835 . - . ... 7 protein_coding CDS 27224055 27224763 . - 0 ... 7 protein_coding start_codon 27224761 27224763 . - 0 ... 7 protein_coding exon 27221134 27222647 . - . ... 7 protein_coding CDS 27222418 27222647 . - 2 ... 7 protein_coding stop_codon 27222415 27222417 . - 0 ... 7 protein_coding UTR 27224764 27224835 . - . ... 7 protein_coding UTR 27221134 27222414 . - . ... - Annotations gene_id "ENSG00000005073"; gene_name "HOXA11"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; ... ... transcript_id "ENST00000006015"; transcript_name "HOXA11-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS5411"; ... exon_number "1"; exon_id "ENSE00001147062"; ... exon_number "1"; protein_id "ENSP00000006015"; ... exon_number "1"; ... exon_number "2"; exon_id "ENSE00002099557"; ... exon_number "2"; protein_id "ENSP00000006015"; ... exon_number "2"; ... ### The [rtracklayer][] package - `import()`: import various formats to `GRanges` and similar instances - `export()`: transform from `GRanges` and similar types to BED, GTF, ... - Also, functions to interactively drive UCSC genome browser with data from _R_ / _Bioconductor_ ## FASTQ files - Sequenced reads: FASTQ files @ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1 CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT + HHGHHGHHHHHHHHDGG>CE?=896=: @ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1 GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC + DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?######################## ### The [ShortRead][] package - `readFastq()`: input - `FastqStreamer()`: iterate through FASTQ files - `FastqSampler()`: sample from FASTQ files, e.g., for quality assessment - Functions for trimming and filters FASTQ files, QA assessment ## Aligned reads - Aligned reads: BAM files - Header @HD VN:1.0 SO:coordinate @SQ SN:chr1 LN:249250621 @SQ SN:chr10 LN:135534747 @SQ SN:chr11 LN:135006516 ... @SQ SN:chrY LN:59373566 @PG ID:TopHat VN:2.0.8b CL:/home/hpages/tophat-2.0.8b.Linux_x86_64/tophat --mate-inner-dist 150 --solexa-quals --max-multihits 5 --no-discordant --no-mixed --coverage-search --microexon-search --library-type fr-unstranded --num-threads 2 --output-dir tophat2_out/ERR127306 /home/hpages/bowtie2-2.1.0/indexes/hg19 fastq/ERR127306_1.fastq fastq/ERR127306_2.fastq - Alignments: ID, flag, alignment and mate ERR127306.7941162 403 chr14 19653689 3 72M = 19652348 -1413 ... ERR127306.22648137 145 chr14 19653692 1 72M = 19650044 -3720 ... ERR127306.933914 339 chr14 19653707 1 66M120N6M = 19653686 -213 ... - Alignments: sequence and quality ... GAATTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCC *'%%%%%#&&%''#'&%%%)&&%%$%%'%%'&*****$))$)'')'%)))&)%%%%$'%%%%&"))'')%)) ... TTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAG '**)****)*'*&*********('&)****&***(**')))())%)))&)))*')&***********)**** ... TGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCT '******&%)&)))&")')'')'*((******&)&'')'))$))'')&))$)**&&**************** - Alignments: Tags ... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:72 YT:Z:UU NH:i:2 CC:Z:chr22 CP:i:16189276 HI:i:0 ... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:72 YT:Z:UU NH:i:3 CC:Z:= CP:i:19921600 HI:i:0 ... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:4 MD:Z:72 YT:Z:UU XS:A:+ NH:i:3 CC:Z:= CP:i:19921465 HI:i:0 ... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:4 MD:Z:72 YT:Z:UU XS:A:+ NH:i:2 CC:Z:chr22 CP:i:16189138 HI:i:0 ### The [GenomicAlignments][] package - `readGAlignments()`: Single-end reads - `readGAlignmentPairs()`, `readGAlignmentsList()`: paired end reads ### Working with large files - `ScanBamParam()`: restrict input - `BamFile(, yieldSize=)`: iteration - [GenomicFiles][] provides useful helpers, e.g., `reduceByYield()` ## Called variants: VCF files - Header ##fileformat=VCFv4.2 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta ##contig= ##phasing=partial ##INFO= ##INFO= ... ##FILTER= ##FILTER= ... ##FORMAT= ##FORMAT= - Location #CHROM POS ID REF ALT QUAL FILTER ... 20 14370 rs6054257 G A 29 PASS ... 20 17330 . T A 3 q10 ... 20 1110696 rs6040355 A G,T 67 PASS ... - Variant INFO #CHROM POS ... INFO ... 20 14370 ... NS=3;DP=14;AF=0.5;DB;H2 ... 20 17330 ... NS=3;DP=11;AF=0.017 ... 20 1110696 ... NS=2;DP=10;AF=0.333,0.667;AA=T;DB ... - Genotype FORMAT and samples ... POS ... FORMAT NA00001 NA00002 NA00003 ... 14370 ... GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. ... 17330 ... GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 ... 1110696 ... GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 ### [VariantAnnotation][] - `readVcf()`: VCF input - `ScanVcfParam()`: restrict input to necessary fields / ranges - `VcfFile()`: indexing and iterating through large VCF files - `locateVariants()`: annotate in relation to genes, etc; see also [ensemblVEP][], [VariantFiltering][] - `filterVcf()`: flexible filtering # Exercises ## _GenomicAlignments_ The [RNAseqData.HNRNPC.bam.chr14][] package is an example of an experiment data package. It contains a subset of BAM files used in a gene knock-down experiment, as described in `?RNAseqData.HNRNPC.bam.chr14`. Load the package and get the path to the BAM files. ```{r} library(RNAseqData.HNRNPC.bam.chr14) fls = RNAseqData.HNRNPC.bam.chr14_BAMFILES basename(fls) ``` Create `BamFileList()`, basically telling R that these are paths to BAM files rather than, say, text files from a spreadsheet. ```{r} library(GenomicAlignments) bfls = BamFileList(fls) bfl = bfls[[1]] ``` Input and explore the alignments. See `?readGAlignments` and `?GAlignments` for details on how to manipulate these objects. ```{r} ga = readGAlignments(bfl) ga table(strand(ga)) ``` Many of the reads have cigar "72M". What does this mean? Can you create a subset of reads that do not have this cigar? Interpret some of the non-72M cigars. Any hint about what these cigars represent? ```{r} tail(sort(table(cigar(ga)))) ga[cigar(ga) != "72M"] ``` Use the function `summarizeJunctions()` to identify genomic regions that are spanned by reads with complicated cigars. Can you use the argument `with.revmap=TRUE` to extract the reads supporting a particular (e.g., first) junction? ```{r} summarizeJunctions(ga) junctions <- summarizeJunctions(ga, with.revmap=TRUE) ga[ junctions$revmap[[1]] ] ``` It is possible to do other actions on BAM files, e.g., calculating the 'coverage' (reads overlapping each base). ```{r} coverage(bfl)$chr14 ``` ## _SummarizedExperiment_ exercise The [airway][] experiment data package summarizes an RNA-seq experiment investigating human smooth-muscle airway cell lines treated with dexamethasone. Load the library and data set. ```{r} library(airway) data(airway) airway ``` `airway` is an example of the _SummarizedExperiment_ class. Explore its `assay()` (the matrix of counts of reads overlapping genomic regions of interest in each sample), `colData()` (a description of each sample), and `rowRanges()` (a description of each region of interest; here each region is an ENSEMBL gene). ```{r} x <- assay(airway) class(x) dim(x) head(x) colData(airway) rowRanges(airway) ``` It's easy to subset a _SummarizedExperiment_ on rows, columns and assays, e.g., retaining just those samples in the `trt` level of the `dex` factor. Accessing elements of the column data is common, so there is a short-cut. ```{r} cidx <- colData(airway)$dex %in% "trt" airway[, cidx] ## shortcut airway[, airway$dex %in% "trt"] ``` It's also easy to perform range-based operations on `SummarizedExperiment` objects, e.g., querying for range of chromosome 14 and then subsetting to contain only genes on this chromosome. Range operations on rows are very common, so there are shortcuts here, too. ```{r} chr14 <- as(seqinfo(rowRanges(airway)), "GRanges")["14"] ridx <- rowRanges(airway) %over% chr14 airway[ridx,] ## shortcut chr14 <- as(seqinfo(airway), "GRanges")["14"] airway[airway %over% chr14,] ``` Use the `assay()` and `rowSums()` function to remove all rows from the `airway` object that have 0 reads overlapping all samples. Summarize the library size (column sums of `assay()`) and plot a histogram of the distribution of reads per feature of interest. ## Annotation and _GenomicFeatures_ Load the org package for _Homo sapiens_. ```{r} library(org.Hs.eg.db) ``` Use `select()` to annotate the HNRNPC gene symbol with its Entrez identifier and less formal gene name. Create a map between SYMBOL and ENTREZID using `mapIds()`. ```{r} select(org.Hs.eg.db, "HNRNPC", c("ENTREZID", "GENENAME"), "SYMBOL") sym2eg <- mapIds(org.Hs.eg.db, "HNRNPC", "ENTREZID", "SYMBOL") ``` Load the TxDb package for the UCSC hg19 knownGene track ```{r} library(TxDb.Hsapiens.UCSC.hg19.knownGene) txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene ``` Extract coordinates of genes, and of exons grouped by gene for the HNRNPC gene. ```{r} gns <- genes(txdb) exonsBy(txdb, "gene")[sym2eg] ``` Use the gene coordinates to query the BAM file for a specific genomic region; see `?ScanBamParam()` for other ways of restricting data input. ```{r} library(Rsamtools) param <- ScanBamParam(which=gns[sym2eg]) readGAlignments(bfl, param=param) ``` ## _AnnotationHub_ The [Roadmap Epigenomics Project][] generated genome-wide maps of regulatory marks across a number of cell lines. Retrieve the Epigenome Roadmap table from [AnnotationHub][]... ```{r} library(AnnotationHub) hub <- AnnotationHub() query(hub, c("epigenome", "metadata")) meta <- hub[["AH41830"]] ``` Explore the metadata to identify a cell line of interest to you; see also the [metadata][] spreadsheet version of the data made available by the Epigenome roadmap project. ```{r} table(meta$ANATOMY) meta[meta$ANATOMY == "LIVER",] ``` Use the 'EID' to query for and retrieve the 'mnemonic' file summarizing chromatin state ```{r} query(hub, c("E118", "mnemonic")) E118 <- hub[["AH46971"]] E118 ``` Explore the object, e.g., tabulating the different chromatin state classifications (in the `name` column). Subset the object to return, e.g., just those regions marked as 'Heterochromatin' ```{r} table(E118$name) E118[E118$name %in% "Heterochromatin"] ``` Can you, using a TxDb package and the `genes()` and `subsetByOverlaps()` functions, determine how many genes overlap heterochromatic states, or the genes `nearest()` each enhancer? ## _biomaRt_ Visit the [biomart website][] and figure out how to browse data to retrieve, e.g., genes on chromosomes 21 and 22. You'll need to browse to the ensembl mart, _Homo spaiens_ data set, establish filters for chromosomes 21 and 22, and then specify that you'd like the Ensembl gene id attribute returned. Now do the same process in [biomaRt][]: ```{r biomart, eval=FALSE} library(biomaRt) head(listMarts(), 3) ## list marts head(listDatasets(useMart("ensembl")), 3) ## mart datasets ensembl <- ## fully specified mart useMart("ensembl", dataset = "hsapiens_gene_ensembl") head(listFilters(ensembl), 3) ## filters myFilter <- "chromosome_name" substr(filterOptions(myFilter, ensembl), 1, 50) ## return values myValues <- c("21", "22") head(listAttributes(ensembl), 3) ## attributes myAttributes <- c("ensembl_gene_id","chromosome_name") ## assemble and query the mart res <- getBM(attributes = myAttributes, filters = myFilter, values = myValues, mart = ensembl) ``` [B.1 Introduction to _Bioconductor_]: ./B1_Bioconductor_Intro.html [Roadmap Epigenomics Project]: http://egg2.wustl.edu/roadmap/web_portal/ [metadata]: https://docs.google.com/spreadsheets/d/1yikGx4MsO9Ei36b64yOy9Vb6oPC5IBGlFbYEt-N6gOM/edit#gid=15 [biomart website]: http://biomart.org [Introduction to VariantAnnotation]: https://bioconductor.org/packages/release/bioc/vignettes/ShortRead/inst/doc/Overview.pdf [AnnotationDbi]: https://bioconductor.org/packages/AnnotationDbi [AnnotationHub]: https://bioconductor.org/packages/AnnotationHub [BSgenome.Hsapiens.UCSC.hg19]: https://bioconductor.org/packages/BSgenome.Hsapiens.UCSC.hg19 [BSgenome]: https://bioconductor.org/packages/BSgenome [Biostrings]: https://bioconductor.org/packages/Biostrings [GenomicAlignments]: https://bioconductor.org/packages/GenomicAlignments [GenomicFeatures]: https://bioconductor.org/packages/GenomicFeatures [GenomicFiles]: https://bioconductor.org/packages/GenomicFiles [GenomicRanges]: https://bioconductor.org/packages/GenomicRanges [HDF5Array]: https://bioconductor.org/packages/HDF5Array [KEGGREST]: https://bioconductor.org/packages/KEGGREST [PSICQUIC]: https://bioconductor.org/packages/PSICQUIC [RNAseqData.HNRNPC.bam.chr14]: https://bioconductor.org/packages/RNAseqData.HNRNPC.bam.chr14 [Rsamtools]: https://bioconductor.org/packages/Rsamtools [ShortRead]: https://bioconductor.org/packages/ShortRead [SummarizedExperiment]: https://bioconductor.org/packages/SummarizedExperiment [TxDb.Hsapiens.UCSC.hg19.knownGene]: https://bioconductor.org/packages/TxDb.Hsapiens.UCSC.hg19.knownGene [VariantAnnotation]: https://bioconductor.org/packages/VariantAnnotation [VariantFiltering]: https://bioconductor.org/packages/VariantFiltering [airway]: https://bioconductor.org/packages/airway [biomaRt]: https://bioconductor.org/packages/biomaRt [GEOquery]: https://bioconductor.org/packages/GEOquery [ensemblVEP]: https://bioconductor.org/packages/ensemblVEP [org.Hs.eg.db]: https://bioconductor.org/packages/org.Hs.eg.db [rtracklayer]: https://bioconductor.org/packages/rtracklayer [AnnotationData]: https://bioconductor.org/packages/release/BiocViews.html#___AnnotationData