############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/R/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings FLAMES_2.1.4.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’ * using R Under development (unstable) (2024-11-24 r87369) * using platform: aarch64-unknown-linux-gnu * R was compiled by aarch64-unknown-linux-gnu-gcc (GCC) 14.2.0 GNU Fortran (GCC) 14.2.0 * running under: openEuler 24.03 (LTS) * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘2.1.4’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... INFO Imports includes 43 non-default packages. Importing from so many packages makes the package vulnerable to any of them becoming unavailable. Move as many as possible to Suggests and use conditionally. * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... WARNING Found the following significant warnings: Warning: program compiled against libxml 212 using older 211 Found the following additional notes/warnings: Non-staged installation was used See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘aarch64-unknown-linux-gnu-g++ (GCC) 14.2.0’ * checking C++ specification ... OK * checking installed package size ... INFO installed size is 5.2Mb sub-directories of 1Mb or more: data 2.7Mb libs 1.4Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... NOTE Warning: program compiled against libxml 212 using older 211 A namespace must be able to be loaded with just the base namespace loaded: otherwise if the namespace gets loaded by a saved object, the session will be unable to start. Probably some imports need to be declared in the NAMESPACE file. * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking dependencies in R code ... NOTE Warning: program compiled against libxml 212 using older 211 * checking S3 generic/method consistency ... WARNING Warning: program compiled against libxml 212 using older 211 See section ‘Generic functions and methods’ in the ‘Writing R Extensions’ manual. * checking replacement functions ... WARNING Warning: program compiled against libxml 212 using older 211 The argument of a replacement function which corresponds to the right hand side must be named ‘value’. * checking foreign function calls ... NOTE Warning: program compiled against libxml 212 using older 211 See chapter ‘System and foreign language interfaces’ in the ‘Writing R Extensions’ manual. * checking R code for possible problems ... NOTE Warning: program compiled against libxml 212 using older 211 create_spe: no visible binding for global variable 'barcode' filter_coverage: no visible global function definition for 'starts_with' filter_coverage: no visible binding for global variable 'filter_res' find_barcode: no visible binding for global variable 'Sample' find_barcode: no visible binding for global variable 'Outfile' find_variants_grange: no visible binding for global variable 'which_label' find_variants_grange: no visible binding for global variable 'nucleotide' find_variants_grange: no visible binding for global variable 'pos' find_variants_grange: no visible binding for global variable 'count' find_variants_grange: no visible binding for global variable 'counts_no_ins' find_variants_grange: no visible binding for global variable 'ref' generate_sc_sce: no visible binding for global variable 'FSM_match' get_coverage: no visible binding for global variable 'Freq' homopolymer_pct : : no visible binding for global variable 'Freq' homopolymer_pct : : no visible binding for global variable 'pct' parse_oarfish_sc_output: no visible binding for global variable '.' plot_coverage: no visible binding for global variable 'tr_length' plot_coverage: no visible binding for global variable 'read_counts' plot_coverage: no visible binding for global variable 'total_counts' plot_coverage: no visible binding for global variable 'cumpct' plot_coverage: no visible binding for global variable 'length_bin' plot_coverage: no visible binding for global variable 'min_length' plot_coverage: no visible binding for global variable 'max_length' plot_coverage: no visible global function definition for 'head' plot_coverage: no visible binding for global variable 'transcript' plot_demultiplex: no visible binding for global variable 'CellBarcode' plot_demultiplex: no visible binding for global variable 'Sample' plot_demultiplex: no visible binding for global variable 'UMI' plot_demultiplex: no visible binding for global variable 'UMI_count' plot_demultiplex: no visible binding for global variable 'barcode_rank' plot_demultiplex: no visible binding for global variable 'FlankEditDist' plot_demultiplex: no visible binding for global variable 'n_reads' plot_demultiplex: no visible binding for global variable 'BarcodeEditDist' plot_demultiplex: no visible binding for global variable 'total reads' plot_demultiplex: no visible binding for global variable 'demultiplexed reads' plot_demultiplex: no visible binding for global variable 'single match reads' plot_demultiplex: no visible binding for global variable 'undemultiplexted reads' plot_demultiplex: no visible binding for global variable 'multi-matching reads' plot_demultiplex: no visible binding for global variable 'Type' plot_demultiplex: no visible binding for global variable 'Reads' plot_demultiplex: no visible binding for global variable 'input' plot_demultiplex: no visible binding for global variable 'output' plot_demultiplex: no visible binding for global variable 'read1_with_adapter' plot_demultiplex: no visible binding for global variable 'Count' plot_flagstat: no visible global function definition for 'everything' plot_flagstat: no visible binding for global variable 'name' plot_flagstat: no visible binding for global variable 'value' plot_isoform_heatmap : group_annotation: no visible global function definition for 'HeatmapAnnotation' plot_isoform_reduced_dim: no visible binding for global variable 'x' plot_isoform_reduced_dim: no visible binding for global variable 'y' plot_isoform_reduced_dim: no visible binding for global variable 'expr' plot_spatial_isoform: no visible global function definition for 'head' plot_spatial_pie: no visible global function definition for 'head' plot_spatial_pie: no visible binding for global variable 'imageY' plot_spatial_pie: no visible binding for global variable 'imageX' relative_mutation_positions: no visible binding for global variable 'region' relative_mutation_positions_single: no visible binding for global variable 'type' sc_DTU_analysis: no visible binding for global variable 'FSM_match' sc_DTU_analysis: no visible binding for global variable 'gene_id' sc_DTU_analysis: no visible binding for global variable '.' sc_DTU_analysis: no visible binding for global variable 'cell_id' sc_DTU_analysis: no visible binding for global variable 'cnt' sc_DTU_analysis: no visible binding for global variable 'tr_id' sc_DTU_analysis: no visible binding for global variable 'label' sc_DTU_analysis : filter_tr: no visible binding for global variable 'gene_id' sc_DTU_analysis : filter_tr: no visible binding for global variable '.' sc_mutations: no visible binding for global variable 'mutation_index' sc_mutations: no visible binding for global variable 'bam_index' variant_count_tb: no visible binding for global variable 'barcode' variant_count_tb: no visible binding for global variable 'allele_count' variant_count_tb: no visible binding for global variable 'cell_total_reads' Undefined global functions or variables: . BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count allele_count bam_index barcode barcode_rank cell_id cell_total_reads cnt count counts_no_ins cumpct demultiplexed reads everything expr filter_res gene_id head imageX imageY input label length_bin max_length min_length multi-matching reads mutation_index n_reads name nucleotide output pct pos read1_with_adapter read_counts ref region single match reads starts_with total reads total_counts tr_id tr_length transcript type undemultiplexted reads value which_label x y Consider adding importFrom("base", "match", "single") importFrom("utils", "head") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... NOTE Found the following Rd file(s) with Rd \link{} targets missing package anchors: bulk_long_pipeline.Rd: SummarizedExperiment sc_long_multisample_pipeline.Rd: SingleCellExperiment sc_long_pipeline.Rd: SingleCellExperiment Please provide package anchors for all Rd \link{} targets not in the package itself and the base packages. * checking for missing documentation entries ... WARNING Warning: program compiled against libxml 212 using older 211 All user-level objects in a package should have documentation entries. See chapter ‘Writing R documentation files’ in the ‘Writing R Extensions’ manual. * checking for code/documentation mismatches ... WARNING Warning: program compiled against libxml 212 using older 211 Warning: program compiled against libxml 212 using older 211 Warning: program compiled against libxml 212 using older 211 * checking Rd \usage sections ... NOTE Warning: program compiled against libxml 212 using older 211 The \usage entries for S3 methods should use the \method markup and not their full name. See chapter ‘Writing R documentation files’ in the ‘Writing R Extensions’ manual. * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... INFO GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/libs/FLAMES.so’: Found ‘abort’, possibly from ‘abort’ (C) Found ‘exit’, possibly from ‘exit’ (C) Found ‘stderr’, possibly from ‘stderr’ (C) Found ‘stdout’, possibly from ‘stdout’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘FLAMES-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: bulk_long_pipeline > ### Title: Pipeline for Bulk Data > ### Aliases: bulk_long_pipeline > > ### ** Examples > > # download the two fastq files, move them to a folder to be merged together > temp_path <- tempfile() > bfc <- BiocFileCache::BiocFileCache(temp_path, ask = FALSE) > file_url <- + "https://raw.githubusercontent.com/OliverVoogd/FLAMESData/master/data" > # download the required fastq files, and move them to new folder > fastq1 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq1", paste(file_url, "fastq/sample1.fastq.gz", sep = "/")))]] > fastq2 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq2", paste(file_url, "fastq/sample2.fastq.gz", sep = "/")))]] > annotation <- bfc[[names(BiocFileCache::bfcadd(bfc, "annot.gtf", paste(file_url, "SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf", sep = "/")))]] > genome_fa <- bfc[[names(BiocFileCache::bfcadd(bfc, "genome.fa", paste(file_url, "SIRV_isoforms_multi-fasta_170612a.fasta", sep = "/")))]] > fastq_dir <- paste(temp_path, "fastq_dir", sep = "/") # the downloaded fastq files need to be in a directory to be merged together > dir.create(fastq_dir) > file.copy(c(fastq1, fastq2), fastq_dir) [1] TRUE TRUE > unlink(c(fastq1, fastq2)) # the original files can be deleted > > outdir <- tempfile() > dir.create(outdir) > se <- bulk_long_pipeline( + annotation = annotation, fastq = fastq_dir, outdir = outdir, genome_fa = genome_fa, + config_file = create_config(outdir, type = "sc_3end", threads = 1, no_flank = TRUE) + ) Writing configuration parameters to: /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/config_file_2766393.json #### Input parameters: { "pipeline_parameters": { "seed": [2022], "threads": [1], "do_barcode_demultiplex": [true], "do_gene_quantification": [true], "do_genome_alignment": [true], "do_isoform_identification": [true], "bambu_isoform_identification": [false], "multithread_isoform_identification": [false], "do_read_realignment": [true], "do_transcript_quantification": [true], "oarfish_quantification": [true] }, "barcode_parameters": { "max_bc_editdistance": [2], "max_flank_editdistance": [8], "pattern": { "primer": ["CTACACGACGCTCTTCCGATCT"], "BC": ["NNNNNNNNNNNNNNNN"], "UMI": ["NNNNNNNNNNNN"], "polyT": ["TTTTTTTTT"] }, "strand": ["-"], "TSO_seq": ["AAGCAGTGGTATCAACGCAGAGTACATGGG"], "TSO_prime": [5], "cutadapt_minimum_length": [10], "full_length_only": [false] }, "isoform_parameters": { "generate_raw_isoform": [false], "max_dist": [10], "max_ts_dist": [100], "max_splice_match_dist": [10], "min_fl_exon_len": [40], "max_site_per_splice": [3], "min_sup_cnt": [5], "min_cnt_pct": [0.001], "min_sup_pct": [0.2], "bambu_trust_reference": [true], "strand_specific": [0], "remove_incomp_reads": [4], "downsample_ratio": [1] }, "alignment_parameters": { "use_junctions": [true], "no_flank": [true] }, "realign_parameters": { "use_annotation": [true] }, "transcript_counting": { "min_tr_coverage": [0.4], "min_read_coverage": [0.4] } } gene annotation: /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/2a3639794e44f7_SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf genome fasta: /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/2a36391853fc4e_SIRV_isoforms_multi-fasta_170612a.fasta input fastq files: /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391a8cf997_sample2.fastq.gz /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391ab61aaf_sample1.fastq.gz output directory: /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc minimap2 path: k8 path: #### Aligning reads to genome using minimap2 Aligning sample 2a36391a8cf997_sample2 ... 08:14:46 Thu Jan 09 2025 minimap2_align Warning in check_forbidden_install("Python packages") : cannot install Python packages during R CMD check Warning in check_forbidden_install("Conda Environments") : cannot install Conda Environments during R CMD check + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda create --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/bins_env 'python=3.8.15' --quiet -c conda-forge -c bioconda --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ## Package Plan ## environment location: /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/bins_env added / updated specs: - python=3.8.15 The following NEW packages will be INSTALLED: _openmp_mutex conda-forge/linux-aarch64::_openmp_mutex-4.5-2_gnu bzip2 conda-forge/linux-aarch64::bzip2-1.0.8-h68df207_7 ca-certificates conda-forge/linux-aarch64::ca-certificates-2024.12.14-hcefe29a_0 ld_impl_linux-aar~ conda-forge/linux-aarch64::ld_impl_linux-aarch64-2.43-h80caac9_2 libffi conda-forge/linux-aarch64::libffi-3.4.2-h3557bc0_5 libgcc conda-forge/linux-aarch64::libgcc-14.2.0-he277a41_1 libgcc-ng conda-forge/linux-aarch64::libgcc-ng-14.2.0-he9431aa_1 libgomp conda-forge/linux-aarch64::libgomp-14.2.0-he277a41_1 liblzma conda-forge/linux-aarch64::liblzma-5.6.3-h86ecc28_1 liblzma-devel conda-forge/linux-aarch64::liblzma-devel-5.6.3-h86ecc28_1 libnsl conda-forge/linux-aarch64::libnsl-2.0.1-h31becfc_0 libsqlite conda-forge/linux-aarch64::libsqlite-3.47.2-h5eb1b54_0 libuuid conda-forge/linux-aarch64::libuuid-2.38.1-hb4cce97_0 libzlib conda-forge/linux-aarch64::libzlib-1.3.1-h86ecc28_2 ncurses conda-forge/linux-aarch64::ncurses-6.5-hcccb83c_1 openssl conda-forge/linux-aarch64::openssl-3.4.0-hd08dc88_1 pip conda-forge/noarch::pip-24.3.1-pyh8b19718_0 python conda-forge/linux-aarch64::python-3.8.15-ha43d526_1_cpython readline conda-forge/linux-aarch64::readline-8.2-h8fc344f_1 setuptools conda-forge/noarch::setuptools-75.3.0-pyhd8ed1ab_0 tk conda-forge/linux-aarch64::tk-8.6.13-h194ca79_0 wheel conda-forge/noarch::wheel-0.45.1-pyhd8ed1ab_0 xz conda-forge/linux-aarch64::xz-5.6.3-h2dbfc1b_1 xz-gpl-tools conda-forge/linux-aarch64::xz-gpl-tools-5.6.3-h2dbfc1b_1 xz-tools conda-forge/linux-aarch64::xz-tools-5.6.3-h86ecc28_1 Preparing transaction: ...working... done Verifying transaction: ...working... done Executing transaction: ...working... done + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/bins_env 'python=3.8.15' -c conda-forge -c bioconda --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ==> WARNING: A newer version of conda exists. <== current version: 24.3.0 latest version: 24.11.2 Please update conda by running $ conda update -n base -c conda-forge conda # All requested packages already installed. + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/bins_env -c conda-forge -c bioconda 'python=3.8.15' 'python=3.8.15' 'oarfish=0.6.2' 'minimap2=2.28' 'samtools=1.21' 'k8=1.2' --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ==> WARNING: A newer version of conda exists. <== current version: 24.3.0 latest version: 24.11.2 Please update conda by running $ conda update -n base -c conda-forge conda ## Package Plan ## environment location: /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/bins_env added / updated specs: - k8=1.2 - minimap2=2.28 - oarfish=0.6.2 - python[version='3.8.15.*,3.8.15.*'] - samtools=1.21 The following NEW packages will be INSTALLED: c-ares conda-forge/linux-aarch64::c-ares-1.34.4-h86ecc28_0 htslib bioconda/linux-aarch64::htslib-1.21-h7068f72_1 k8 bioconda/linux-aarch64::k8-1.2-h7f4e536_2 keyutils conda-forge/linux-aarch64::keyutils-1.6.1-h4e544f5_0 krb5 conda-forge/linux-aarch64::krb5-1.21.3-h50a48e9_0 libcurl conda-forge/linux-aarch64::libcurl-8.11.1-h6702fde_0 libdeflate conda-forge/linux-aarch64::libdeflate-1.22-h86ecc28_0 libedit conda-forge/linux-aarch64::libedit-3.1.20240808-pl5321h976ea20_0 libev conda-forge/linux-aarch64::libev-4.33-h31becfc_2 libnghttp2 conda-forge/linux-aarch64::libnghttp2-1.64.0-hc8609a4_0 libssh2 conda-forge/linux-aarch64::libssh2-1.11.1-ha41c0db_0 libstdcxx conda-forge/linux-aarch64::libstdcxx-14.2.0-h3f4de04_1 libstdcxx-ng conda-forge/linux-aarch64::libstdcxx-ng-14.2.0-hf1166c9_1 minimap2 bioconda/linux-aarch64::minimap2-2.28-h0cbc5ad_4 oarfish bioconda/linux-aarch64::oarfish-0.6.2-h42e9ff9_0 python_abi conda-forge/linux-aarch64::python_abi-3.8-5_cp38 samtools bioconda/linux-aarch64::samtools-1.21-h0b41a95_1 zlib conda-forge/linux-aarch64::zlib-1.3.1-h86ecc28_2 zstd conda-forge/linux-aarch64::zstd-1.5.6-h02f22dd_0 Downloading and Extracting Packages: ...working... done Preparing transaction: ...working... done Verifying transaction: ...working... done Executing transaction: ...working... done [M::mm_idx_gen::0.016*0.98] collected minimizers [M::mm_idx_gen::0.027*0.99] sorted minimizers [M::main::0.027*0.99] loaded/built the index for 7 target sequence(s) [M::mm_mapopt_update::0.029*0.99] mid_occ = 14 [M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7 [M::mm_idx_stat::0.030*0.99] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947; total length: 223019 [M::worker_pipeline::8.599*0.99] mapped 2500 sequences [M::main] Version: 2.24-r1122 [M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/2a36391853fc4e_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391a8cf997_sample2.fastq.gz [M::main] Real time: 8.605 sec; CPU: 8.511 sec; Peak RSS: 0.112 GB Aligning sample 2a36391ab61aaf_sample1 ... 08:16:32 Thu Jan 09 2025 minimap2_align [M::mm_idx_gen::0.015*0.82] collected minimizers [M::mm_idx_gen::0.026*0.90] sorted minimizers [M::main::0.026*0.90] loaded/built the index for 7 target sequence(s) [M::mm_mapopt_update::0.029*0.91] mid_occ = 14 [M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7 [M::mm_idx_stat::0.031*0.91] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947; total length: 223019 [M::worker_pipeline::8.416*0.99] mapped 2500 sequences [M::main] Version: 2.24-r1122 [M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/2a36391853fc4e_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391ab61aaf_sample1.fastq.gz [M::main] Real time: 8.423 sec; CPU: 8.310 sec; Peak RSS: 0.079 GB 08:16:41 Thu Jan 09 2025 find_isoform Warning in check_forbidden_install("Python packages") : cannot install Python packages during R CMD check Warning in check_forbidden_install("Conda Environments") : cannot install Conda Environments during R CMD check + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda create --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env 'python=3.11.9' --quiet -c conda-forge -c bioconda --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ## Package Plan ## environment location: /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env added / updated specs: - python=3.11.9 The following NEW packages will be INSTALLED: _openmp_mutex conda-forge/linux-aarch64::_openmp_mutex-4.5-2_gnu bzip2 conda-forge/linux-aarch64::bzip2-1.0.8-h68df207_7 ca-certificates conda-forge/linux-aarch64::ca-certificates-2024.12.14-hcefe29a_0 ld_impl_linux-aar~ conda-forge/linux-aarch64::ld_impl_linux-aarch64-2.43-h80caac9_2 libexpat conda-forge/linux-aarch64::libexpat-2.6.4-h5ad3122_0 libffi conda-forge/linux-aarch64::libffi-3.4.2-h3557bc0_5 libgcc conda-forge/linux-aarch64::libgcc-14.2.0-he277a41_1 libgcc-ng conda-forge/linux-aarch64::libgcc-ng-14.2.0-he9431aa_1 libgomp conda-forge/linux-aarch64::libgomp-14.2.0-he277a41_1 liblzma conda-forge/linux-aarch64::liblzma-5.6.3-h86ecc28_1 liblzma-devel conda-forge/linux-aarch64::liblzma-devel-5.6.3-h86ecc28_1 libnsl conda-forge/linux-aarch64::libnsl-2.0.1-h31becfc_0 libsqlite conda-forge/linux-aarch64::libsqlite-3.47.2-h5eb1b54_0 libuuid conda-forge/linux-aarch64::libuuid-2.38.1-hb4cce97_0 libxcrypt conda-forge/linux-aarch64::libxcrypt-4.4.36-h31becfc_1 libzlib conda-forge/linux-aarch64::libzlib-1.3.1-h86ecc28_2 ncurses conda-forge/linux-aarch64::ncurses-6.5-hcccb83c_1 openssl conda-forge/linux-aarch64::openssl-3.4.0-hd08dc88_1 pip conda-forge/noarch::pip-24.3.1-pyh8b19718_2 python conda-forge/linux-aarch64::python-3.11.9-hddfb980_0_cpython readline conda-forge/linux-aarch64::readline-8.2-h8fc344f_1 setuptools conda-forge/noarch::setuptools-75.6.0-pyhff2d567_1 tk conda-forge/linux-aarch64::tk-8.6.13-h194ca79_0 tzdata conda-forge/noarch::tzdata-2024b-hc8b5060_0 wheel conda-forge/noarch::wheel-0.45.1-pyhd8ed1ab_1 xz conda-forge/linux-aarch64::xz-5.6.3-h2dbfc1b_1 xz-gpl-tools conda-forge/linux-aarch64::xz-gpl-tools-5.6.3-h2dbfc1b_1 xz-tools conda-forge/linux-aarch64::xz-tools-5.6.3-h86ecc28_1 Preparing transaction: ...working... done Verifying transaction: ...working... done Executing transaction: ...working... done + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env 'python=3.11.9' -c conda-forge -c bioconda --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ==> WARNING: A newer version of conda exists. <== current version: 24.3.0 latest version: 24.11.2 Please update conda by running $ conda update -n base -c conda-forge conda # All requested packages already installed. + /home/biocbuild/.cache/R/basilisk/1.19.0/0/bin/conda install --yes --prefix /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env -c conda-forge -c bioconda 'python=3.11.9' 'python=3.11.9' 'numpy=2.1.1' 'scipy=1.14.1' 'pysam=0.22.1' 'cutadapt=4.9' 'tqdm=4.66.5' 'pandas=2.2.3' --override-channels Channels: - conda-forge - bioconda Platform: linux-aarch64 Collecting package metadata (repodata.json): ...working... done Solving environment: ...working... done ==> WARNING: A newer version of conda exists. <== current version: 24.3.0 latest version: 24.11.2 Please update conda by running $ conda update -n base -c conda-forge conda ## Package Plan ## environment location: /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env added / updated specs: - cutadapt=4.9 - numpy=2.1.1 - pandas=2.2.3 - pysam=0.22.1 - python[version='3.11.9.*,3.11.9.*'] - scipy=1.14.1 - tqdm=4.66.5 The following packages will be downloaded: package | build ---------------------------|----------------- zlib-ng-2.2.3 | hf428078_0 107 KB conda-forge ------------------------------------------------------------ Total: 107 KB The following NEW packages will be INSTALLED: c-ares conda-forge/linux-aarch64::c-ares-1.34.4-h86ecc28_0 cffi conda-forge/linux-aarch64::cffi-1.17.1-py311h14e8bb7_0 colorama conda-forge/noarch::colorama-0.4.6-pyhd8ed1ab_1 cutadapt bioconda/linux-aarch64::cutadapt-4.9-py311he810f1b_3 dnaio bioconda/linux-aarch64::dnaio-1.2.2-py311h9d58220_0 isa-l conda-forge/linux-aarch64::isa-l-2.31.0-h68df207_2 keyutils conda-forge/linux-aarch64::keyutils-1.6.1-h4e544f5_0 krb5 conda-forge/linux-aarch64::krb5-1.21.3-h50a48e9_0 libblas conda-forge/linux-aarch64::libblas-3.9.0-26_linuxaarch64_openblas libcblas conda-forge/linux-aarch64::libcblas-3.9.0-26_linuxaarch64_openblas libcurl conda-forge/linux-aarch64::libcurl-8.11.1-h6702fde_0 libdeflate conda-forge/linux-aarch64::libdeflate-1.22-h86ecc28_0 libedit conda-forge/linux-aarch64::libedit-3.1.20240808-pl5321h976ea20_0 libev conda-forge/linux-aarch64::libev-4.33-h31becfc_2 libgfortran conda-forge/linux-aarch64::libgfortran-14.2.0-he9431aa_1 libgfortran5 conda-forge/linux-aarch64::libgfortran5-14.2.0-hb6113d0_1 liblapack conda-forge/linux-aarch64::liblapack-3.9.0-26_linuxaarch64_openblas libnghttp2 conda-forge/linux-aarch64::libnghttp2-1.64.0-hc8609a4_0 libopenblas conda-forge/linux-aarch64::libopenblas-0.3.28-pthreads_h9d3fd7e_1 libssh2 conda-forge/linux-aarch64::libssh2-1.11.1-ha41c0db_0 libstdcxx conda-forge/linux-aarch64::libstdcxx-14.2.0-h3f4de04_1 libstdcxx-ng conda-forge/linux-aarch64::libstdcxx-ng-14.2.0-hf1166c9_1 numpy conda-forge/linux-aarch64::numpy-2.1.1-py311he9aa9f1_0 pandas conda-forge/linux-aarch64::pandas-2.2.3-py311h848c333_1 pbzip2 conda-forge/linux-aarch64::pbzip2-1.1.13-ha36d286_2 pigz conda-forge/linux-aarch64::pigz-2.8-h194ca79_0 pycparser conda-forge/noarch::pycparser-2.22-pyh29332c3_1 pysam bioconda/linux-aarch64::pysam-0.22.1-py311h3a7b516_3 python-dateutil conda-forge/noarch::python-dateutil-2.9.0.post0-pyhff2d567_1 python-isal conda-forge/linux-aarch64::python-isal-1.7.1-py311ha879c10_0 python-tzdata conda-forge/noarch::python-tzdata-2024.2-pyhd8ed1ab_1 python-zlib-ng conda-forge/linux-aarch64::python-zlib-ng-0.5.1-py311hbded170_0 python_abi conda-forge/linux-aarch64::python_abi-3.11-5_cp311 pytz conda-forge/noarch::pytz-2024.1-pyhd8ed1ab_0 scipy conda-forge/linux-aarch64::scipy-1.14.1-py311h5912639_2 six conda-forge/noarch::six-1.17.0-pyhd8ed1ab_0 tqdm conda-forge/noarch::tqdm-4.66.5-pyhd8ed1ab_0 xopen conda-forge/noarch::xopen-2.0.2-pyh707e725_2 zlib-ng conda-forge/linux-aarch64::zlib-ng-2.2.3-hf428078_0 zstandard conda-forge/linux-aarch64::zstandard-0.23.0-py311hd5293d8_1 zstd conda-forge/linux-aarch64::zstd-1.5.6-h02f22dd_0 Downloading and Extracting Packages: ...working... done Preparing transaction: ...working... done Verifying transaction: ...working... done Executing transaction: ...working... done Collecting fast-edit-distance==1.2.2 Using cached fast_edit_distance-1.2.2-cp311-cp311-linux_aarch64.whl Collecting blaze2==2.5.1 Using cached blaze2-2.5.1-py3-none-any.whl.metadata (13 kB) Collecting matplotlib==3.9.1 Using cached matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (11 kB) Collecting cython (from fast-edit-distance==1.2.2) Using cached Cython-3.0.11-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (3.2 kB) Requirement already satisfied: tqdm in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from blaze2==2.5.1) (4.66.5) Requirement already satisfied: numpy in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from blaze2==2.5.1) (2.1.1) Requirement already satisfied: pandas in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from blaze2==2.5.1) (2.2.3) Collecting contourpy>=1.0.1 (from matplotlib==3.9.1) Using cached contourpy-1.3.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (5.4 kB) Collecting cycler>=0.10 (from matplotlib==3.9.1) Using cached cycler-0.12.1-py3-none-any.whl.metadata (3.8 kB) Collecting fonttools>=4.22.0 (from matplotlib==3.9.1) Using cached fonttools-4.55.3-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (165 kB) Collecting kiwisolver>=1.3.1 (from matplotlib==3.9.1) Downloading kiwisolver-1.4.8-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl.metadata (6.2 kB) Collecting packaging>=20.0 (from matplotlib==3.9.1) Using cached packaging-24.2-py3-none-any.whl.metadata (3.2 kB) Collecting pillow>=8 (from matplotlib==3.9.1) Downloading pillow-11.1.0-cp311-cp311-manylinux_2_28_aarch64.whl.metadata (9.1 kB) Collecting pyparsing>=2.3.1 (from matplotlib==3.9.1) Downloading pyparsing-3.2.1-py3-none-any.whl.metadata (5.0 kB) Requirement already satisfied: python-dateutil>=2.7 in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from matplotlib==3.9.1) (2.9.0.post0) Requirement already satisfied: six>=1.5 in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from python-dateutil>=2.7->matplotlib==3.9.1) (1.17.0) Requirement already satisfied: pytz>=2020.1 in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from pandas->blaze2==2.5.1) (2024.1) Requirement already satisfied: tzdata>=2022.7 in /home/biocbuild/.cache/R/basilisk/1.19.0/FLAMES/2.1.4/flames_env/lib/python3.11/site-packages (from pandas->blaze2==2.5.1) (2024.2) WARNING: The candidate selected for download or install is a yanked version: 'matplotlib' candidate (version 3.9.1 at https://files.pythonhosted.org/packages/54/7e/4f8f44fcc65a8cfa6303d3469d8973d6a2ba019a9627af9a9ae545f718d6/matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (from https://pypi.org/simple/matplotlib/) (requires-python:>=3.9)) Reason for being yanked: The Windows wheels, under some conditions, caused segfaults in unrelated user code. Due to this we deleted the Windows wheels to prevent these segfaults, however this caused greater disruption as pip then began to try (and fail) to build 3.9.1 from the sdist on Windows which impacted far more users. Yanking the whole release is the only tool available to eliminate these failures without changes to on the user side. The sdist, OSX wheel, and manylinux wheels are all functional and there are no critical bugs in the release. Downstream packagers should not yank their builds of Matplotlib 3.9.1. See https://github.com/matplotlib/matplotlib/issues/28551 for details. Using cached blaze2-2.5.1-py3-none-any.whl (45.7 MB) Using cached matplotlib-3.9.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (8.2 MB) Using cached contourpy-1.3.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (313 kB) Using cached cycler-0.12.1-py3-none-any.whl (8.3 kB) Using cached fonttools-4.55.3-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (4.9 MB) Downloading kiwisolver-1.4.8-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (1.4 MB) ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 1.4/1.4 MB 39.3 MB/s eta 0:00:00 Using cached packaging-24.2-py3-none-any.whl (65 kB) Downloading pillow-11.1.0-cp311-cp311-manylinux_2_28_aarch64.whl (4.4 MB) ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 4.4/4.4 MB 81.8 MB/s eta 0:00:00 Downloading pyparsing-3.2.1-py3-none-any.whl (107 kB) Using cached Cython-3.0.11-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl (3.4 MB) Installing collected packages: pyparsing, pillow, packaging, kiwisolver, fonttools, cython, cycler, contourpy, matplotlib, fast-edit-distance, blaze2 Successfully installed blaze2-2.5.1 contourpy-1.3.1 cycler-0.12.1 cython-3.0.11 fast-edit-distance-1.2.2 fonttools-4.55.3 kiwisolver-1.4.8 matplotlib-3.9.1 packaging-24.2 pillow-11.1.0 pyparsing-3.2.1 #### Read gene annotations Removed similar transcripts in gene annotation: Counter({'duplicated_transcripts': 2}) #### find isoforms SIRV1 SIRV2 SIRV3 SIRV4 SIRV5 SIRV6 SIRV7 #### Realign to transcript using minimap2 Realigning sample 2a36391a8cf997_sample2 ... 08:18:09 Thu Jan 09 2025 minimap2_realign [M::mm_idx_gen::0.004*1.16] collected minimizers [M::mm_idx_gen::0.007*1.73] sorted minimizers [M::main::0.007*1.73] loaded/built the index for 83 target sequence(s) [M::mm_mapopt_update::0.008*1.67] mid_occ = 18 [M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 83 [M::mm_idx_stat::0.009*1.63] distinct minimizers: 4795 (32.58% are singletons); average occurrences: 3.250; average spacing: 5.399; total length: 84155 [M::worker_pipeline::0.913*2.46] mapped 2500 sequences [M::main] Version: 2.24-r1122 [M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/transcript_assembly.fa /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391a8cf997_sample2.fastq.gz [M::main] Real time: 0.915 sec; CPU: 2.248 sec; Peak RSS: 0.030 GB file renamed to 2a36391a8cf997_sample2_realign2transcript.bam Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) : cannot remove file '/home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/2a36391a8cf997_sample2_tmp_align.bam', reason 'No such file or directory' Realigning sample 2a36391ab61aaf_sample1 ... 08:18:10 Thu Jan 09 2025 minimap2_realign [M::mm_idx_gen::0.004*0.70] collected minimizers [M::mm_idx_gen::0.007*1.43] sorted minimizers [M::main::0.007*1.42] loaded/built the index for 83 target sequence(s) [M::mm_mapopt_update::0.008*1.39] mid_occ = 18 [M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 83 [M::mm_idx_stat::0.008*1.37] distinct minimizers: 4795 (32.58% are singletons); average occurrences: 3.250; average spacing: 5.399; total length: 84155 [M::worker_pipeline::1.233*2.50] mapped 2500 sequences [M::main] Version: 2.24-r1122 [M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/transcript_assembly.fa /home/biocbuild/tmp/RtmpgqjqVC/file2a36391372b344/fastq_dir/2a36391ab61aaf_sample1.fastq.gz [M::main] Real time: 1.235 sec; CPU: 3.087 sec; Peak RSS: 0.032 GB file renamed to 2a36391ab61aaf_sample1_realign2transcript.bam Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) : cannot remove file '/home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/2a36391ab61aaf_sample1_tmp_align.bam', reason 'No such file or directory' #### Generating transcript count matrix 2025-01-09T08:18:11.924310Z  INFO oarfish: setting user-provided filter parameters. 2025-01-09T08:18:11.927759Z  INFO oarfish::alignment_parser: read header from BAM file /home/biocbuild/tmp/RtmpgqjqVC/file2a36392bc5e3bc/2a36391a8cf997_sample2_realign2transcript.bam, contains 83 reference sequences. thread 'main' panicked at src/alignment_parser.rs:29:10: has inner header note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace Error in run_oarfish(realign_bam, outdir, threads = config$pipeline_parameters$threads, : error running oarfish: 134 Calls: bulk_long_pipeline ... quantify_transcript -> quantify_transcript_oarfish -> run_oarfish Execution halted * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 1 ERROR, 5 WARNINGs, 7 NOTEs See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’ for details.